Forum ŚFiNiA Strona Główna ŚFiNiA
ŚFiNiA - Światopoglądowe, Filozoficzne, Naukowe i Artystyczne forum - bez cenzury, regulamin promuje racjonalną i rzeczową dyskusję i ułatwia ucinanie demagogii. Forum założone przez Wuja Zbója.
 
 FAQFAQ   SzukajSzukaj   UżytkownicyUżytkownicy   GrupyGrupy   GalerieGalerie   RejestracjaRejestracja 
 ProfilProfil   Zaloguj się, by sprawdzić wiadomościZaloguj się, by sprawdzić wiadomości   ZalogujZaloguj 

Czy ewolucja biologiczna potrzebowala Boga Kreatora?
Idź do strony Poprzedni  1, 2, 3, 4  Następny
 
Napisz nowy temat   Odpowiedz do tematu    Forum ŚFiNiA Strona Główna -> Genesis
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Czw 3:06, 09 Mar 2006    Temat postu:

wujzboj-
Cytat:
Maynardzie, tu jest sfinski hlefik, a nie swinski chlewik. Tu sie nie miesza z blotem, tu sie czysci argumentami.


Ja mieszam z blotem przy zastosowaniu argumento Wuju-Zboju :D

pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Czw 5:53, 09 Mar 2006    Temat postu: Re: Poklosie...

Cytat:
Kto to jest Ernst Mayr chyba nie trzeba Ci przedstawiać? Dodam tylko dla innych że jest to współtwórca syntetycznej teorii ewolucji czyli złączenia biologii systematycznej z genetyką.
No ale maynard tradycyjnie przypisze to do tego że ta ocena zmieniła się w ciągu tym razem nie 10 a 5 lat.


Przeciez nikt nie przeczy ,ze luki w zapisie kopalnym istnieja. Jednak znamy juz tysiace skamielin laczacych rozne taksony. Np. te prawalenie, o ktorych mowiles, ze sa to powszechnie znane fakty. Niemniej i tak jest to kropla w morzu. No niestety fosylizacja to rzadkie zjawisko, a jeszcze odnalesc zfosylizowana forme przejsciowa to juz cud. Ciesz sie wiec-albo nie ciesz- z tych tysiecy odnalezionych kopalnych swiadectw ewolucji. I nie zapominaj o tych porownaniach molekularnych. Tak szczerze piszac to sa one najprawdziwszymi dowodami na makroewolucje. Te kopalne znaleziska dostarczaja tylko potwierdzenia tym molekularnym.

Stary te 30.000.000 mutacji to pryszcz dla ewolucji. Ty sie urodziles i rozniles sie juz kilkoma tysiacami mutacji od mamy i taty. Teraz sobie to pomnoz przez 300.000 pokolen i wielkosc populacji, ktora dla pierwotnych antropoidow, jak i hominidow wynosila jakies kilka milionow sztuk, na w miare lokalnym obszarze, co umozliwialo szybki przeplyw genow,a co za tym idzie latwe rozpowszechnianie sie mutacji korzystnych.


Cytat:
Gdyby tak to liczyć to nie będzie żadnego problemu.
Np. 5 000 x 300 000 pokoleń daje aż półtora miliarda mutacji nie licząc ilości osobników co jest olbrzymią liczbą w stosunku do 35 milionów mutacji. Ale chyba nie tak należy to liczyc.


UFFFFFFFFFFFFFFFFFFF nareszcie pi razy drzwi zalapales. Widze zes nie taki ciemny jak myslalem.
Ja musze tylko sprostowac. Od mamy i taty roznisz sie kilkomaset mutacjami,a nie kilkoma tysiacami. Przepraszam pomylilo mi sie z mutacjami w komorkach somatycznych, ktore powstaja podczas roznicowania sie tych komorek. Wowczas mowimy nawet o milionach mutacji.

Zegar molekularny, metoda szacowania chronologii wydarzeń ewolucyjnych (rozdzielenia się poszczególnych linii filogenetycznych; zob. filogeneza) przez porównywanie ilościowych różnic w sekwencjach aminokwasów w odpowiadających sobie białkach lub nukleotydów w DNA u różnych organizmów. Metoda zegara molekularnego opiera się na gradualistycznym założeniu, że tempo narastania różnic (mutacji) jest mniej więcej stałe (zwłaszcza w niekodujących odcinkach genomu) w poszczególnych sekwencjach i w danej grupie. Im większe różnice, tym dawniej rozdzieliły się porównywane grupy. Zegar kalibruje się na podstawie danych paleontologicznych lub paleogeograficznych (czas rozejścia się kontynentów, na których żyją badane grupy) dotyczących niektórych rozgałęzień. Tą metodą uzyskano m.in. wskazówkę, że drogi ludzi i szympansów (różniących się ok. 1 % sekwencji DNA) rozeszły się dopiero ok. 6 mln lat temu.


Cytat:
Od razu mam pytanie ile z tych kilku tysięcy to mutacje korzystne.


O taki ton mi sie podoba. Jesli chodzi o mutacje korzystne, to sa one rzadkim zjawiskiem w porownaniu do tych zlych.Niemniej masz juz pewien obraz tj. iloma eksperymentami postuzyla sie ewolucja-metoda prob i bledow- zeby wypracowac te 2% roznic miedzy szympansem i czlowiekiem. Teraz sobie wyobraz ile malpiszonow wyladowalo w piachu-bo wiele z tych milionow mutacji okazalo sie letalnych- zeby Oless stal sie czlowiekiem. No i nie przyznasz racji Dawkinsowi ktory powiedzial ,iz wiecej jest sposobow na umieranie niz przezywanie. :D

Tu masz skrotowo jak to sie kalibruje, na podstawie jakich zalozen i odniesien:

[link widoczny dla zalogowanych]


Cytat:
Połącz też to z obliczeniami dotyczącymi zastępowania starych cech przez nowe. Jeśli weźmiesz przykładowo populację jednego miliona osobników to ile zajmuje rozprzestrzenienie się tej nowej cechy i wypieranie starych (gdyby uprościć że jedna mutacja i zmiana nukleotydu w genie wprowadza nową cechę).


Stary takie wyliczenia masz np. w ponizszej ksiazce. Jesli chcesz rozmawiac o ewolucji i matematycznych modelach ewolucji to dawno powinienes ja przeczytac.....


[link widoczny dla zalogowanych]
Zarys mechanizmów ewolucji - Krzanowska Halina, Łomnicki Adam

Musisz zrozumiec jak dziala ewolucja. Zrozumiec na prostym przykladzie,a dopiero sie brac za wyliczenia, ktorymi zajmuja sie matematycy wyzsi. Facet przestan sie porywac z motyka na slonce, poniewaz po pierwsze nie wiesz o czym piszesz ,po drugie nie rozumiesz regul jakie rzadza ewolucja.

Wyjasnie Ci to prosto:

Wyobraz sobie jakas sekwencje-

ACCGCCACCTTTCAACTTCAAC

Teraz sobie wyobraz ,ze musza pojawic sie 3 konkretne mutacje i na 3 konkretnych miejscach tej sekwencji, aby organizm dostosowal sie do jakiegos tam srodowiska:

TCCGTCACCTTTCTACTTCAAC

Teraz mamy mutanta z pierwsza trafiona mutacja T-1:


TCCGCCACCTTTCAACTTCAAC

Jesli zalozymy ,ze mamy tylko do czynienia z jednym osobnikiem to szansa trafienia dwoch pozostalych mutacji T-2 i T-3 jest niewielka. Jest natomiast wieksza, gdy mamy do czynienia z wieksza iloscia osobnikow-populacja z mutacja od ktorej startuje nasza ewolucja: T-1, a ktore to sie rozmnazaja i maja szanse, aby w ich potomstwie pojawila sie mutacja najpierw T-2 i w kolejnych pokoleniach mutacja T-3 :

TCCGCCACCTTTCAACTTCAAC


TCCGCCACCTTTCAACTTCAAC


TCCGCCACCTTTCAACTTCAAC


TCCGCCACCTTTCAACTTCAAC


TCCGCCACCTTTCAACTTCAAC


TCCGCCACCTTTCAACTTCAAC


TCCGCCACCTTTCAACTTCAAC


TCCGCCACCTTTCAACTTCAAC


TCCGCCACCTTTCAACTTCAAC


A czy szansa rozprzestrzenienia sie takiej mutacji w populacji jest duza. Znowu wyjasnie Ci to na przykladzie. Wyobraz sobie malpiszona w pierwotnej populacji antropoidow. Mutacja T-1 spowodowala ,ze stal sie on silniejszy od innych samcow i zdobyl wysoka pozycje w hierarhii. Co za tym idzie zaczal pokrywac wiecej samic od slabszych samcow. Co za tym idzie zaczal plodzic wiecej potomstwa od tych slabszych samcow i przekazywac ta dobra mutacje\ceche owemu potomstwu. Teraz silne potomstwo, z odziedziczona mutacja T-1 ,rowniez plodzi wiecej potomstwa od innych samcow i tak -po niedlugim czasie mutacja T-1 opanowuje cala populacje pierwotnych malpiszonow. Teraz kolej na mutacje T-2 i pozniej T-3. A wiec, jak Ci tlumaczylem wczesniej, wlasciwe pojawienie sie mutacji T-2 jest teraz bardziej prawdopodobne niz pojawienie sie mutacji T-1 od ktorej startowala omawiana ewolucja. Pozniej mutacja T-2 rozpowszechnia sie w populacji na tych samych zasadach co mutacja T-1 i kolej na mutacje T-3, ktora powstanie teraz z taka sama latwoscia co mutacja T-2. Czy teraz zalapales na czym ten proces mniej wiecej polega.

Oto piekna nalalogia. Mutacja korzysta dziala dokladnie jak infekcja i sie rozpowszechnia jak epidemia. Najpierw sie roprzestrzenia, pozniej trafia na przszkode w postaci np. ograniczen nakladanych poprzez pojemnosc srodowiska naturalnego. :D

No i co najwazniejsze: w ewolucji dziala dobor kumulatywny, co jeszcze bardziej uprawdapadabnia ewolucje. Malo tego czasami kilka roznych mutacji moze prowadzic do tego samego efektu. Np. istnieja bialka o tej samej konformacji-ksztalcie ,a jednak o roznej sekwencji aminokwasow tworzacych lancuch polipeptydowy.

Tak, ze widzisz co warte sa wszelkie wyliczenia kretynocjonistow i fachowcow kontestatorow. :D


Cytat:
No cóż rozumiem że w tym upatrujesz swój sens tutaj , i masz poczucie misji. ;P
To mój ostatni post do ciebie. Ta gadka nie jest warta cennego czasu.


Mojego czy Twojego....


Cytat:
Odpowiadając na wątkowe pytanie czy ewolucja potrzebuje boga można odpowiedzieć że nie ale odwracając pytanie czy wszystko w ewolucji jest wyjaśnione a znane mechanizmy są wystarczające? I wtedy otrzyma się odpowiedź że na pewno nie.


Oczywiscie nie wszystko jest wyjasnione, niemniej mechanizmy ewolucji juz poznalismy. Reszta to doszlifowanie szczegolow.


Cytat:
czy L. Spetner ( Not by Chance) i postulują aktywną samoorganizację. Chyba się orientujesz że to sprzeczne z klasycznym neodarwinizmem.


Na Alternatywie o2. wyprostowalem komus myslenie na temat Spetnera
http://www.alternatywa.fora.pl/viewtopic.php?p=985#985
i jego kretynskich wywodow na temat mutacji sterowanych ROTLF. Dr. Spetner to kontestator i takie zdanie ma wielu biologow. Jak sie czujesz na silach mozemy pogadac o jego kretynskich koncepcjach. Na gruncie biologii Ci wykaze jakie to pierdoly. Oczywiscie najpierw wykaz ,ze wogole rozumiesz koncepcje Spetnera, poniewaz glowe daje,ze znowu poprzepisywales od jakiegos IDioty.

"in biology nothing makes sense
except in the light of evolution"

Theodosius Dobzhansky

Jak cos to nie musisz wcale dezerterowac, jesli tylko zachowasz-przynajmniej- ten poziom co teraz duzo sie mozesz dowiedziec. Tylko powoli chlopie, zrozum najpierw proste sprawy ,a pozniej bierz sie za te bardziej skomplikowane.

pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
Oless




Dołączył: 05 Sty 2006
Posty: 2139
Przeczytał: 0 tematów

Skąd: Łódź
Płeć: Mężczyzna

PostWysłany: Pią 16:04, 10 Mar 2006    Temat postu:

Maynard napisał:

Ja musze tylko sprostowac. Od mamy i taty roznisz sie kilkomaset mutacjami,a nie kilkoma tysiacami. Przepraszam pomylilo mi sie z mutacjami w komorkach somatycznych, ktore powstaja podczas roznicowania sie tych komorek. Wowczas mowimy nawet o milionach mutacji.


Właśnie dlatego jesteś moim idolem. Jak ja się pomyliłem to oszukiwałem i nie wiedziałem o czym mówię a ty to po prostu niedoprecyzowałeś i musisz tylko sprostować ;P
no ale poza tym gadasz całkiem do rzeczy. Tak jak powiedziałem na razie muszę skończyć i nie odpowiem na wszytko , co nie znaczy że kiedyś nie zamierzam ale skupiając się na tempie zmian to właśnie trzymam w ręku "Zarys mechanizmów ewolucji" PWN Wa-wa 2002 .
O wrażeniach napiszę w domu.

Edit:
Cytacik z tej ciekawej książki 2.6.1"Tempo mutacji":
"Mutacje zachodzą najcześciej podczas replikacji DNA, wskutek pomyłek w parowaniu zasad przez polimerazę w czasie syntezy komplementarnych nici DNA; szacuje się że ryzyko błędu na tym etapie wynosi 1 na 10 do 4.
Jednakże cześstość tych błędów zmniejsza się 100-1000 razy w wyniku korekty przeprowadzonej przez polimerazę DNA, która jest białkiem złożonym i wielofunkcyjnym, przy czym jedna z jego składowych ma właściwość wycinania mylnie wstawionych nukleotydów, umożliwiając umieszczenia prawidłowego. Dokładność powielania sekwencji DNA zależy w dużym stopniu od właściwego działania polimerazy DNA, a mutacje w genie kodującym ten enzym mogą upośledzać (lub usprawniać) jego funkcję, zwiększając (lub zmniejszając) częstośc zachodzenia mutacji w innych genach (Siwińska '74). Szansa utrzymania się błędu zmniejsza się następnie 100 razy w wyniku poreplikacyjnego działania enzymów naprawczych, które ze źle sparowanych fragmentów wycinają nić świeżo skopiowaną i dobudowują nową według sekwencji na nici pierwotnej. Dopiero, jeżeli i ten system zawiedzie, powstaje mutacja. W wyniku działania wszystkich tych mechanizmów częstość mutacji , w przeliczeniu na 1 zasadę i na 1 replikację, wynosi od 10 do potęgi -8 do 10 do potęgi -9. (Maynard Smith '89) "

Nie wiem czy masz twój nick to specjalne nawiązanie czy zbieżność ale w każdym bądź razie wynikałoby z obliczeń tego Maynarda że na 4 miliardy par zasad przypada 4-40 mutacji, jeśli dobrze policzyłem.

Tempo mutacji z 1 błędem na miliard nukleotydów to raczej ustalona liczba , identyczną podaje wikipedia oraz [link widoczny dla zalogowanych]

Czyli poprawny jest wniosek że gdyby uznać że rodzice mają identyczny genom to ich dziecko będzie posiadało średnio 22 nukleotydów różniących się w umiejscowieniu od oryginału?
Zautoryzuj wypowiedź albo generalnie napisz jaka byłaby ta liczba i pójdziemy dalej.

Jeszcze jedno z głupich pytań , jeśli rodzice posiadają odmienny gen to tylko jeden z nich otrzymuje dziecko dobrze to sobie wyobrażam?
Na razie tyle. :mrgreen:
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
motek




Dołączył: 07 Mar 2006
Posty: 565
Przeczytał: 0 tematów

Skąd: Wrocław

PostWysłany: Pią 18:07, 10 Mar 2006    Temat postu:

nie prześledziłem dokładnie tej dyskusji (nie mam siły odfiltrowywać merytorycznych treści od wzajemnych inwektyw)

zwróce tylko uwagę na zasadniczy błąd w rozumowaniu kolegi maynarda

maynard napisał:
-Nasze drogi oddechowe sa skrzyzowane z pokarmowymi co powoduje m in. wspomniane zadlawienia...

Oj lista ludzkich bubli jest jeszcze dluzsza, ale mysle ,ze to wystarczy zebys zrozumial intencje Zaroffa...

A Biblia,w Ksiedze Rodzaju, mowi, ze wszystko co uczynil Bog bylo bardzo dobre. Albo w Psalmie, ze wszystkie jego dziela sa doskonale i nic im nie brakuje...Bez komentarza.


w czym rzecz

1. błednie rozumiesz sens słowa "inteligentny". Ten przymiotnik nie jest tożsamy z przymiotnikami: "hipergenialny", "nieomylny", "perfekcyjny", "bezbłędny" itd. Dlatego istnienie błędów nie moze stanowic dowodu przeciwko inteligencji.
Bo chyba nie powiesz Maynardzie, ze gdybyś wylądował na jakiejs tajemnicej wyspie i znalazł na skale napis z kilkoma błędami ortograficznymi i gramatycznymi, to stwierdziłbys, ze na tej wyspie nie ma istot inteligentnych.

Więcej powiem: błędy są nieodłączną cechą projektu! Sam jestem projektantem, więc wiem to doskonale. Błędy są nader często nieuniknione. Kiedyś nawet udowodniłem, że jest geometrycznie niemożliwe narysowanie projektu mieszkania, który by nie zawierał rozwiązania błędnego z punktu widzenia akademickich zasad projektowania.
Projektowanie jest z natury sztuką kompromisu, a kompromis to świadoma zgoda na błąd.

Jest róznica mięzy rozwiązaniem bezbłędnym, a rozwiązaniem optymalnym.

2. Nie za bardzo rozumiem, czemu ktytykujac teorie inteligentnego projektu odwołujesz się do Biblii, a nie do prac zwoleników ID. podejrzewam, że po prostu niedokądnie wiesz, czym jest teoria ID.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
anbo




Dołączył: 09 Lut 2006
Posty: 3519
Przeczytał: 46 tematów


PostWysłany: Nie 15:42, 12 Mar 2006    Temat postu:

motek napisał:
błędy są nieodłączną cechą projektu


Czyjego projektu? Nieomylnego Boga też?

motek napisał:
Projektowanie jest z natury sztuką kompromisu, a kompromis to świadoma zgoda na błąd.

Z kim Bóg musiał zawierać kompromis? Chyba tylko z sobą, prawda? To z czego i dlaczego oraz na rzecz czego musiał rezygnować?

motek napisał:
Jest róznica mięzy rozwiązaniem bezbłędnym, a rozwiązaniem optymalnym.


Z pewnoscią. O ile jednak optymalne w wydaniu człowieka to "najlepsze na jakie go stać" (a na bezbłędne go nie stać, bo brak mu nieomylności i wszechwiedzy), to optymalne w wydaniu Boga - ? Co Boga ogranicza? Nie omylnośc, bo nieomylny, nie brak wiedzy, bo wszechwiedzący. Więc co?

anbo
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
motek




Dołączył: 07 Mar 2006
Posty: 565
Przeczytał: 0 tematów

Skąd: Wrocław

PostWysłany: Nie 17:00, 12 Mar 2006    Temat postu:

anbo napisał:
motek napisał:
błędy są nieodłączną cechą projektu


Czyjego projektu? Nieomylnego Boga też?


projektu. kropka

Teoria inteligentnego projektu z zasady nie snuje dywagacji na temat natury demiurga, pozostawiając tą kwestię teologom i mistykom.

Cytat:
motek napisał:
Projektowanie jest z natury sztuką kompromisu, a kompromis to świadoma zgoda na błąd.

Z kim Bóg musiał zawierać kompromis? Chyba tylko z sobą, prawda?


nieprawda

każdy projektant zawiera kompromis z warunkami wyjściowymi. W tym przypadku warunki można określic tak:

Materia ożywiona
1. składa się z materii
2. jest zdolna do samopowielania się
3. czerpie energię i budulec z materii
itd.itd.

Oczywicie demiurg mógł przyjąc inne warunki, ale jakieś przyjąć musiał, bo inaczej nic by nie stworzył.

Tak czy siak sa to spekulacje, które wykraczaja poza obserwacje empiryczne, więc teoria ID sie nimi nie zajmuje.


Cytat:
To z czego i dlaczego oraz na rzecz czego musiał rezygnować?


np. musiał zrezygnować z nieograniczonej wytrzymałości materiałów na sciskanie i zginanie, z niezerowej oporności przewodników. Mnóstwo tego jest.


Cytat:
motek napisał:
Jest róznica mięzy rozwiązaniem bezbłędnym, a rozwiązaniem optymalnym.


Z pewnoscią. O ile jednak optymalne w wydaniu człowieka to "najlepsze na jakie go stać" (a na bezbłędne go nie stać, bo brak mu nieomylności i wszechwiedzy)


błąd!

Nie ma mowy o niewiedzy!
Rozwiąznie optymalne przyjmowane jest z pełna swiadomościa błędów, na które sie jednak godzimy, gdyż ich korekta jest możliwa tylko kosztem innych błędnych rozwiązań. Optymalnośc polega na zgodzie na te błędy, które będa najmniej osłabiały całość rozwiązania.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Nie 20:34, 12 Mar 2006    Temat postu:

Cytat:
no ale poza tym gadasz całkiem do rzeczy. Tak jak powiedziałem na razie muszę skończyć i nie odpowiem na wszytko , co nie znaczy że kiedyś nie zamierzam ale skupiając się na tempie zmian to właśnie trzymam w ręku "Zarys mechanizmów ewolucji" PWN Wa-wa 2002 .
O wrażeniach napiszę w domu.


No widze, ze skorzystales z mojej rady i zaczeles sie uczyc, zakupujac pozycje do ktorej dalem Ci linka :D


Kod:
Edit:
Cytacik z tej ciekawej książki  2.6.1"Tempo mutacji":
"Mutacje zachodzą najcześciej podczas replikacji DNA, wskutek pomyłek w parowaniu zasad przez polimerazę w czasie syntezy komplementarnych nici DNA; szacuje się że ryzyko błędu na tym etapie wynosi 1 na 10 do 4.
Jednakże cześstość tych błędów zmniejsza się 100-1000 razy w wyniku korekty przeprowadzonej przez polimerazę DNA, która jest białkiem złożonym i wielofunkcyjnym, przy czym jedna z jego składowych ma właściwość wycinania mylnie wstawionych nukleotydów, umożliwiając umieszczenia prawidłowego. Dokładność powielania sekwencji DNA zależy w dużym stopniu od właściwego działania polimerazy DNA, a mutacje w genie kodującym ten enzym mogą upośledzać (lub usprawniać) jego funkcję, zwiększając (lub zmniejszając) częstośc zachodzenia mutacji w innych genach (Siwińska '74).  Szansa utrzymania się błędu zmniejsza się następnie 100 razy w wyniku poreplikacyjnego działania enzymów naprawczych, które ze źle sparowanych fragmentów wycinają nić świeżo skopiowaną i dobudowują nową według sekwencji na nici pierwotnej. Dopiero, jeżeli i ten system zawiedzie, powstaje mutacja. W wyniku działania wszystkich tych mechanizmów częstość mutacji ,  w przeliczeniu na 1 zasadę i na 1 replikację, wynosi od  10 do potęgi -8  do 10 do potęgi -9. (Maynard Smith '89) "

Nie wiem czy masz twój nick to specjalne nawiązanie czy zbieżność ale w każdym bądź razie wynikałoby z obliczeń tego Maynarda że na 4 miliardy par zasad przypada 4-40 mutacji, jeśli dobrze policzyłem.

Tempo mutacji z 1 błędem na miliard nukleotydów to raczej ustalona liczba , identyczną podaje wikipedia oraz http://www.ids.edu.pl/wwwbio/genetyka/mm_19.html.

Czyli poprawny jest wniosek że gdyby uznać że rodzice mają identyczny genom to ich dziecko będzie posiadało średnio 22 nukleotydów różniących się w umiejscowieniu od oryginału?
Zautoryzuj wypowiedź albo generalnie napisz jaka byłaby ta liczba i pójdziemy dalej.



Cholera i znowu to samo: Oless przeczytal pierwszy lepszy fragment i juz mysli ,ze posiadl wiedze biologiczna, ktora gromadzilo kilka pokolen badaczy :D

J.M. Smith wylicza tu ilosc mutacji przypadajaca na replikacje jednego genomu. Rzeczywiscie mutacje to rzadkie zjawisko, niemniej J.M. Smith-niewatpliwie jeden z jawybitniejszych biologow ewolucyjnych- nie jest jedynym autorem takich wyliczen, ktore poza tym zle zrozumiales. Nas tu jednak interesuje, czy ilosc mutacji, powstajacych u organizmow wyzszych rozmnazajacych sie plciowo, wystarczy do zajscia ewolucji. Teraz sobie wyobraz, ze gonady np. H.sapiens, czy szympansie skladaja sie z kilkudziesieciu miliardow komorek. Owe komorki powstaly z jednej pierwotnej zaplodnionej komorki, w wyniku kulku tysiecy cyklow replikaceyjnych. Najpierw powstawaly: jedna z drugiej , pozniej cztery z dwoch, osiem z czterech, szesnascie z osmiu itd. itd. itd, az do rozwiniecia sie gonad w procesie ontogenezy. Linia roznicujacych sie komorek wiodaca od zaplodnionej zygoty do komorek lini generatywnej- do ktorych naleza m. in. plemniki i jaja-kumuluje wszystkie mutacje , ktore zaszly w czasie roznicowania sie tych komorek. Pozniej z tych komorek, wchodzacych w sklad gonad, powstaja na drodze mejozy gamety, ktore kumuluja te mutacje, jakie byly juz wczesniej obecne w komorkach gametotworczych. W meskiej lini generatywnej komorki z ktorych powstaja gamety, czyli plemniki proliferuja przez cale zycie osobnika. Podczas takiego osobniczego samczego zycia powstaja miliardy plemnikow, a wiec i komorki gametotworcze musza przez ten czas proliferowac, co zwieksza oczywiscie ilosc mutacji przekazywanych ewentualnemu potomstwu. W zenskiej lini generatywnej powstaje tylko kilkadziesiat takich komorek, z to ktorych powstaja jaja, co znacznie ogranicza ilosc mutacji. Niemniej biorac pod uwage mutacje jakie osobniki zenskie dziedzicza z procesu roznicowania to tez jest ich niemalo.
Czy teraz zrozumiales iloma mutacjami moze sie roznic potomek od rodzica. Oless ja Ci dam dobra rade: doucz sie, poczytaj ,a dopiero pozniej probuj kogos przekonywac do swoich racji.
I daruj sobie te kretynskie uwagi w stylu: maynard teraz piszesz do rzeczy, poniewaz to przestaje byc zabawne.
Z reszta jesli chcesz strugac dalej glupka to prosze bardzo.

pzdr.


Ostatnio zmieniony przez maynard dnia Pon 4:33, 13 Mar 2006, w całości zmieniany 1 raz
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Nie 20:47, 12 Mar 2006    Temat postu:

Do Motka i Anbo:

Nie mialem zamiaru sie wcinac, poniewaz kolega Anbo odpowiedzial za mnie. Ale ,ze post pierwotnie skierowano do mojej osoby cos niecos dodam. Swoja droga dzieki Anbo ,ze mnie czasami wyreczasz, poniewaz nie mam juz sil ani czasu odpowiadac na wszystkie mitomanskie zarzuty i naiwne pytanie moich, mnozacych sie ponad miare, adwersarzy.


motek-
Cytat:
Projektowanie jest z natury sztuką kompromisu, a kompromis to świadoma zgoda na błąd.




anbo-
Cytat:
Z kim Bóg musiał zawierać kompromis? Chyba tylko z sobą, prawda?




motek-
Cytat:
nieprawda

każdy projektant zawiera kompromis z warunkami wyjściowymi. W tym przypadku warunki można określic tak:



Warunki wyjsciowe materialnego swiata tez zostaly wykreowane przez rzekomego Kreatora. Przynajmniej tak postuluja kreacjonisci. Czesto z duma powoluja sie na Zasade Antropiczna i przypisuja taka forme swiata Kreatorowi wlasnie. Widze jednak ,iz w imie obrony Kreatora, czy jakiejs kreatury, ktora spartaczyla swiat, niektorzy teisci gotowi sa ograniczyc funkcje uzytecznosci Kreatora i poddac go prawom, ktorych pierwotne zaistnienie jemu wlasnie przypisywano. No brawo i gratuluje logiki, tylko co na to Stworca rzeczy widzialnych i niewidzialnych :D :D :D :D :D :D :D


pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
motek




Dołączył: 07 Mar 2006
Posty: 565
Przeczytał: 0 tematów

Skąd: Wrocław

PostWysłany: Nie 21:58, 12 Mar 2006    Temat postu:

maynard napisał:
Warunki wyjsciowe materialnego swiata tez zostaly wykreowane przez rzekomego Kreatora.


Co nie to znaczy, że sie z nimi nie liczył.


Powtarzam. Teoria ID nie stawia tezy, że demiurg jest bezbłędnym i nieomylnym geniuszem - zatem obalając tezę której ID nie stawia, w żaden sposób nie podważasz ID.


P.S. nwektywami tez niczgo nie udowadniasz, poza własnym brakiem ogłady
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Nie 22:25, 12 Mar 2006    Temat postu:

maynard napisał:
Ja mieszam z blotem przy zastosowaniu argumento Wuju-Zboju

Prosze wiec, bys zrezygnowal z blota. Bowiem blota musi uzywac tylko ten, kto sie boi, ze jego argumenty nie utrzymaja sie bez blota.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Pon 1:27, 13 Mar 2006    Temat postu:

maynard-
Warunki wyjsciowe materialnego swiata tez zostaly wykreowane przez rzekomego Kreatora.

motek-
Cytat:
Co nie to znaczy, że sie z nimi nie liczył.


Znaczy mam rozumiec ,ze liczyl sie z nimi zanim je wykreowal :D


Cytat:
Powtarzam. Teoria ID nie stawia tezy, że demiurg jest bezbłędnym i nieomylnym geniuszem - zatem obalając tezę której ID nie stawia, w żaden sposób nie podważasz ID.


Nie ma czegos takiego jak Teoria ID. Na miano teorii naukowej nalezy sobie zasluzyc. Poki co-i co najwyzej- jest hopoteza ID. Jak ja potwierdzicie wowczas moze zostanie Teoria ID.

pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
motek




Dołączył: 07 Mar 2006
Posty: 565
Przeczytał: 0 tematów

Skąd: Wrocław

PostWysłany: Pon 12:18, 13 Mar 2006    Temat postu:

maynard napisał:
Cytat:
Co nie to znaczy, że sie z nimi nie liczył.


Znaczy mam rozumiec ,ze liczyl sie z nimi zanim je wykreowal :D


może
jesłi lubisz takie spekulacje pozbawione podstaw empirycznych, to sobie je snuj

ale nie wymagaj tego ode mnie bo ja jestem racjonalny


Cytat:
Cytat:
Powtarzam. Teoria ID nie stawia tezy, że demiurg jest bezbłędnym i nieomylnym geniuszem - zatem obalając tezę której ID nie stawia, w żaden sposób nie podważasz ID.


Nie ma czegos takiego jak Teoria ID. Na miano teorii naukowej nalezy sobie zasluzyc. Poki co-i co najwyzej- jest hopoteza ID. Jak ja potwierdzicie wowczas moze zostanie Teoria ID.


OK
jest to hipoteza ID i stawia ona takie tezy, jakie stawia, anie takie jakie Tobie sie wydaje, że stawia.

Powtarzam więc: hipoteza ID nie stawia tezy o doskonałości i bezbłędności demiurga

Wogóle nic nie mówi o demiurgu, bo dotyczy wyłącznie przyrody ożywionej
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
anbo




Dołączył: 09 Lut 2006
Posty: 3519
Przeczytał: 46 tematów


PostWysłany: Pon 17:35, 13 Mar 2006    Temat postu:

motek napisał:
Teoria inteligentnego projektu z zasady nie snuje dywagacji na temat natury demiurga, pozostawiając tą kwestię teologom i mistykom.

Ale ty snujesz. Tłumaczysz wskazane błędy, to tłumaczenie jest konkretne, w związku z nim mam pytania, proszę na nie odpowiedzieć.

motek napisał:

nieprawda [że Kreator musiał zawierać kompromis sam z sobą]
każdy projektant zawiera kompromis z warunkami wyjściowymi.

Warunki wyjściowe Kreator życia zastał, czy je stworzył (w postaci materii z prawami nią rządzącymi)? Jeśli je stworzył, to prawda.

motek napisał:
Oczywicie demiurg mógł przyjąc inne warunki, ale jakieś przyjąć musiał, bo inaczej nic by nie stworzył.

Pytanie jest dlaczego te warunki musiały być takie, że potem pojawiły się błędy w projekcie. Kreator zrobił to celowo, tak mu wyszło przez przypadek, z jakichś powodów nie mógł stworzyć projektu bezbłędnego, czy coś go ograniczało? Ponieważ wcześniej błędy tłumaczyłeś ograniczeniami (o dziwo ludzkimi, a przecież rzecz nie dotyczy człowieka), to pytam o te ograniczające Kreatora czynniki. Najwyraźniej leżą w jego naturze, a nie naturze materiału jaki miał do dyspozycji, skoro on jest twórcą także tego materiału.

motek napisał:
Tak czy siak sa to spekulacje, które wykraczaja poza obserwacje empiryczne, więc teoria ID sie nimi nie zajmuje.


Raz: ty się nimi zająłeś, z tobą dyskutuję. Dwa: ID wykracza poza obserwacje empiryczne w momencie, gdy dla wyjaśnienia obserwacji empirycznych postuluje bliżej nieokreślonego i nieobserwowalnego empirycznie Kreatora. Trzy: O jego istnieniu wnosi z obserwacji empirycznych, nie widzę więc powodu, by na bazie tych samych obserwacji nie podywagować na temat natury Kreatora.

motek napisał:
np. musiał [Kreator] zrezygnować z nieograniczonej wytrzymałości materiałów na sciskanie i zginanie, z niezerowej oporności przewodników. Mnóstwo tego jest.

Dlaczego uważasz, że nie można stworzyć przewodnika o zerowej oporności idt.? Kreator nie mógł, bo przeszkodziłoby to w osiągnięciu jakiegoś celu, czy nie mógł, bo nikt czegoś takiego nie potrafi?
Potrafisz wykazać związek niezerowej oporności przewodników z koniecznością "skrzyzowania naszych dróg oddechowych z pokarmowymi co powoduje m in. wspomniane zadlawienia"?

motek napisał:
błąd [O ile jednak optymalne w wydaniu człowieka to "najlepsze na jakie go stać" (a na bezbłędne go nie stać, bo brak mu nieomylności i wszechwiedzy)]!
Nie ma mowy o niewiedzy!

W przypadku człowieka? A to przepraszam, wszyscy ludzie, jakich do tej pory poznałem, okazywali się w czymś niedouczeni, czegoś nie wiedzieli, dlatego popełniali błędy. Sorrki za uogólnienie wszystkich tych nieomylnych znanych tobie.

motek napisał:
Rozwiąznie optymalne przyjmowane jest z pełna swiadomościa błędów, na które sie jednak godzimy, gdyż ich korekta jest możliwa tylko kosztem innych błędnych rozwiązań.


Czyli w ludzkiej działalności błędy muszą się pojawić, ale nie dlatego, że ludzie mają za mało wiedzy (mają pełnię wiedzy o świecie, w którym żyją?), a dostępne dane analizują błędnie (analizują bezbłędnie?), ale dlatego, że taka jest natura świata, w którym umieścił ich kreator? Obawiam się, że będzie ci trudno wykazać pełnię wiedzy i bezbłędnośc wnioskowania, ewentualnie brak związku błędów w ludzkiej działalności z ludzką niewiedzą i omylnością.

anbo
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Pon 19:37, 13 Mar 2006    Temat postu:

motek-
Cytat:
Co nie to znaczy, że sie z nimi nie liczył.


Znaczy mam rozumiec ,ze liczyl sie z nimi zanim je wykreowal :D

Cytat:
może
jesłi lubisz takie spekulacje pozbawione podstaw empirycznych, to sobie je snuj


Poki co dyskutujemy i domagam sie uzasadnienia Twoich tez, Ty za to nie potrafiac odpowiedziec i probujesz obrocic kota ogonem :D

Cytat:
ale nie wymagaj tego ode mnie bo ja jestem racjonalny


Cytat:
Powtarzam. Teoria ID nie stawia tezy, że demiurg jest bezbłędnym i nieomylnym geniuszem - zatem obalając tezę której ID nie stawia, w żaden sposób nie podważasz ID.


Z ktorej strony jestes racjonalny.. Jakie Ty masz dowody popierajace Twoje, rzekomo, racjonalne myslenie. Czy aby nie probujesz udowodnic istnienia Niedoskonalego Projektu W Przyrodzie powolujac sie na niedoskonaly projekt w owej przyrodzie :D


Nie ma czegos takiego jak Teoria ID. Na miano teorii naukowej nalezy sobie zasluzyc. Poki co-i co najwyzej- jest hopoteza ID. Jak ja potwierdzicie wowczas moze zostanie Teoria ID.

Cytat:
OK
jest to hipoteza ID i stawia ona takie tezy, jakie stawia, anie takie jakie Tobie sie wydaje, że stawia.


No widzisz kolego a TE jest teoria naukowa...a wiesz dlaczego. M. in. dlatego ,ze TE stawia testowalne przewidywania, a ID dopasowuje ideologie do faktow.

Cytat:
Wogóle nic nie mówi o demiurgu, bo dotyczy wyłącznie przyrody ożywionej


A gdzie Ty w przyrodzie widzisz swojego demiurga. Powiedz to sie tym Noblem podzialkujemy :D


pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
Ks.Marek




Dołączył: 22 Lut 2006
Posty: 1116
Przeczytał: 0 tematów

Skąd: Oikumene
Płeć: Mężczyzna

PostWysłany: Pon 23:59, 13 Mar 2006    Temat postu:

Panowie, w kwestii formalnej, zobaczcie co jest przedmiotem formalnym:
a. Filozofii
b. Teologii
c. Ogólnie pojętych nauk przyrodniczych

Nie czytałem całego wątku waszych dywagacji, ale zasugerować mogę zapoznanie sie z osobą i poglądami niejakiego Pierre`a Teilhard`a de Chardin`a. Może ów pomoże wam dojść do jakiegoś konsensusu?. To tyle mojego wkładu w te dyskusję.

Pozdrawiam
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Wto 0:05, 14 Mar 2006    Temat postu:

Ks.Marek napisał:
Panowie, w kwestii formalnej, zobaczcie co jest przedmiotem formalnym:
a. Filozofii
b. Teologii
c. Ogólnie pojętych nauk przyrodniczych

Nie czytałem całego wątku waszych dywagacji, ale zasugerować mogę zapoznanie sie z osobą i poglądami niejakiego Pierre`a Teilhard`a de Chardin`a. Może ów pomoże wam dojść do jakiegoś konsensusu?. To tyle mojego wkładu w te dyskusję.

Pozdrawiam


Na katolikach wlasnie o tym obrzydliwym typie dyskutowalem :D
[link widoczny dla zalogowanych]

pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
motek




Dołączył: 07 Mar 2006
Posty: 565
Przeczytał: 0 tematów

Skąd: Wrocław

PostWysłany: Wto 11:20, 14 Mar 2006    Temat postu:

anbo napisał:
motek napisał:
Teoria inteligentnego projektu z zasady nie snuje dywagacji na temat natury demiurga, pozostawiając tą kwestię teologom i mistykom.

Ale ty snujesz.

nie

Cytat:
Tłumaczysz wskazane błędy

nie

Cytat:
to tłumaczenie jest konkretne, w związku z nim mam pytania, proszę na nie odpowiedzieć.

po co?

co za róznica?

błądy są cechą inteligentnego projektu

Cytat:
motek napisał:
nieprawda [że Kreator musiał zawierać kompromis sam z sobą]
każdy projektant zawiera kompromis z warunkami wyjściowymi.

Warunki wyjściowe Kreator życia zastał, czy je stworzył (w postaci materii z prawami nią rządzącymi)?

nie wiem

Hipoteza ID to nie opowieści zycia demiurgów. To paradoks, ale własnie zwolennicy ewoluji poświęcają takim spekulacjom mnówstwo czasu.


Cytat:
Jeśli je stworzył, to prawda.

niech Ci będzie

w takim razie, skoro tak świetnie znasz naturę demuirgów, to udowodnij, że kompormis z samym sobą, to rzecz niemożliwa u demiurgów

sobie to udowodnij - bo mnie takie dzikie irracjonalne spekulacje w ogóle nie interesują


Cytat:
motek napisał:
Oczywicie demiurg mógł przyjąc inne warunki, ale jakieś przyjąć musiał, bo inaczej nic by nie stworzył.

Pytanie jest dlaczego te warunki musiały być takie, że potem pojawiły się błędy w projekcie.
Kreator zrobił to celowo, tak mu wyszło przez przypadek, z jakichś powodów nie mógł stworzyć projektu bezbłędnego, czy coś go ograniczało?


takie sobie pytania

rozumiem, że masz komu je zadać (wywiad z demiurgiem?)

nadal nie interesują mnie takie irracjonalne dywagacje


Cytat:
Ponieważ wcześniej błędy tłumaczyłeś ograniczeniami (o dziwo ludzkimi, a przecież rzecz nie dotyczy człowieka)


był to przykład
Jak na razie jedyne przykłady obiektów, o których wiemy na pewno, że zostały zaprojektowane, to projekty wykonane przez człowieka. Jesłi więc chcemy poznać cechy projektu, musimy zbadać te obiekty, a potem porównać z nimi organizmy żywe.

Okazuje się, że błędy to właśnie cecha, podobna u organizmów żywych i w projektach.


Cytat:
to pytam o te ograniczające Kreatora czynniki.


a ja, jako człowiek racjonalny, odmawiam takich dzikich spekulacji

Cytat:
Najwyraźniej leżą w jego naturze, a nie naturze materiału jaki miał do dyspozycji, skoro on jest twórcą także tego materiału.


acha

skoro wiesz skądś, że nieograniczony demiurg nie jest w stanie stworzyc ograniczonej materii... nie zaprzecaam - na gruncie mojego racjonalizmu nie zweryfikuje tej tezy

ale może w takim razie sprawdż teraz co może, a czego nie może ograniczony demiurg

Cytat:
motek napisał:
Tak czy siak sa to spekulacje, które wykraczaja poza obserwacje empiryczne, więc teoria ID sie nimi nie zajmuje.


Raz: ty się nimi zająłeś


nie

ja sie zajmowałem cechami projektu,
nie spekulowaniem nt. natury demiurgów ograniczonych i nieograniczonych

Cytat:
Dwa: ID wykracza poza obserwacje empiryczne w momencie, gdy dla wyjaśnienia obserwacji empirycznych postuluje bliżej nieokreślonego i nieobserwowalnego empirycznie Kreatora.


tylko że ten moment nie następuje

ja w każdym razie nie postuluję demiurga - ani obserwowalnego, ani nieobserwowalnego, ani żadnego.


Cytat:
Trzy: O jego istnieniu wnosi z obserwacji empirycznych


nie

ID niczego nie wnosi o żadnym demiurgu ani kreatorze


Cytat:
nie widzę więc powodu, by na bazie tych samych obserwacji nie podywagować na temat natury Kreatora.


a ja widze, gdyz jestem racjonalny

ten powód: kompletny brak danych empirycznych

Cytat:
motek napisał:
np. musiał [Kreator] zrezygnować z nieograniczonej wytrzymałości materiałów na sciskanie i zginanie, z niezerowej oporności przewodników. Mnóstwo tego jest.

Dlaczego uważasz, że nie można stworzyć przewodnika o zerowej oporności idt.?


nie wnoszę tego

stwierdzam tylko naukowy fakt, że materia z której powstały organizmy żywe nie ma takich cech


Cytat:
Kreator nie mógł, bo przeszkodziłoby to w osiągnięciu jakiegoś celu, czy nie mógł, bo nikt czegoś takiego nie potrafi?


Nie znam sie na demurgologii więc mnie nie pytaj. Z Twoich wypopwiedziwnosze, że to Twoja dziedzina.

Cytat:
Potrafisz wykazać związek niezerowej oporności przewodników z koniecznością "skrzyzowania naszych dróg oddechowych z pokarmowymi co powoduje m in. wspomniane zadlawienia"?

nie

Ale gdyby np. powietrze i płyny wykazywały większą dynamikę, to można byłoby jedna gruba dwufunkcyjną rurkę zastąpić dwiema cienkimi o wyspecjalizowanych funkcjach. Albo gdyby matriał do budowy przełyku miał większą wytrzymałość, to jego ścianki mogłyby być znacznie cieńsze, a tym samym jego zewnętrzna średnica węższa.

Tutaj mamy bardzo złożony system zależności i należy dokładnie zbadać koszty związane z przyjęciem błędnego rozwiązania.

A tak na marginesie: jaki odsetek osobników ponosi śmierć lub uszczerbek na zdrowiu właśnie z powodu zadławienia?

Cytat:
motek napisał:
błąd [O ile jednak optymalne w wydaniu człowieka to "najlepsze na jakie go stać" (a na bezbłędne go nie stać, bo brak mu nieomylności i wszechwiedzy)]!
Nie ma mowy o niewiedzy!

W przypadku człowieka?


ogólnie tak
ale w przypadku rozwiązań optymalnych projektanci zazwyczaj są świadomi błedów rozwiązania. Wiedzą, że kompromisowo przyjęli błędne rozwiązania. Wiele wad rozwiązania projektanci świadomie akceptuja godząc sie na nie.

Sam jestem projektantem i wiem, że moje rozwiązania mają wady.


Cytat:
motek napisał:
Rozwiąznie optymalne przyjmowane jest z pełna swiadomościa błędów, na które sie jednak godzimy, gdyż ich korekta jest możliwa tylko kosztem innych błędnych rozwiązań.


Czyli w ludzkiej działalności błędy muszą się pojawić, ale nie dlatego, że ludzie mają za mało wiedzy (mają pełnię wiedzy o świecie, w którym żyją?), a dostępne dane analizują błędnie (analizują bezbłędnie?)


niezależnie od tego

Czy sa doskonali, czy ułomni - błędy są nieuniknione.


Cytat:
, ale dlatego, że taka jest natura świata, w którym umieścił ich kreator?

taka jest natura świata. kropka

Cytat:
Obawiam się, że będzie ci trudno wykazać pełnię wiedzy i bezbłędnośc wnioskowania, ewentualnie brak związku błędów w ludzkiej działalności z ludzką niewiedzą i omylnością.


po co mam wykazywac tezę, której nie stawiam, z która sie nie zgadzam i która nie jest potrzbna do poparcia mojej argumentacji?

dla sportu?
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
Ks.Marek




Dołączył: 22 Lut 2006
Posty: 1116
Przeczytał: 0 tematów

Skąd: Oikumene
Płeć: Mężczyzna

PostWysłany: Wto 11:25, 14 Mar 2006    Temat postu:

maynard napisał:
Na katolikach wlasnie o tym obrzydliwym typie dyskutowalem


Takie pisanie czy tez mowienie dyskfalifikuje Cie jako oponenta w dysusji. Odsłaniasz sie maynardzie w wąskości swojego myślenia. To nienaukowe i nieprofesjonalne podejscie do tematu - no, chyba ze jakos racjonalnie wykazesz obrzydliwosc De Chardina.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
motek




Dołączył: 07 Mar 2006
Posty: 565
Przeczytał: 0 tematów

Skąd: Wrocław

PostWysłany: Wto 11:35, 14 Mar 2006    Temat postu:

maynard napisał:
motek-
Cytat:
Co nie to znaczy, że sie z nimi nie liczył.


Znaczy mam rozumiec ,ze liczyl sie z nimi zanim je wykreowal :D


odmawiam irracjonalnych spekulacji - pozostaję na gruncie empirii


Cytat:
Cytat:
może
jesłi lubisz takie spekulacje pozbawione podstaw empirycznych, to sobie je snuj


Poki co dyskutujemy i domagam sie uzasadnienia Twoich tez


wcale nie postawiłem tezy, której uzasadnienia sie domagasz


Cytat:
, Ty za to nie potrafiac odpowiedziec i probujesz obrocic kota ogonem :D


nie umiem bronić tez, których nie stawiam i z którymi sie nie zgadzam

a Ty umiesz?


Cytat:
Cytat:
Powtarzam. Teoria ID nie stawia tezy, że demiurg jest bezbłędnym i nieomylnym geniuszem - zatem obalając tezę której ID nie stawia, w żaden sposób nie podważasz ID.


Z ktorej strony jestes racjonalny


na gruncie empirii nie snuję dywagacji na temat natury demiurga - Ty i anbo to robicie

Cytat:
Czy aby nie probujesz udowodnic istnienia Niedoskonalego Projektu W Przyrodzie powolujac sie na niedoskonaly projekt w owej przyrodzie :D


W oparciu o empirę analizuje cechy projektów i porównuje je z cechami organizmów żywych. Dostrzegam mnóstwo podobieństw.
Nie dostrzegam natomiast istotnych podobieństw między materią zywa, a wytworami procesów samoczynnych i niekierowanych.


Cytat:
Cytat:
OK
jest to hipoteza ID i stawia ona takie tezy, jakie stawia, anie takie jakie Tobie sie wydaje, że stawia.


No widzisz kolego a TE jest teoria naukowa...a wiesz dlaczego. M. in. dlatego ,ze TE stawia testowalne przewidywania


na razie Ty i anbo snujecie kompletnie nieweryfikowalne spekulacje na temat róznych typów demiurgów. Ja konsekwentnie odmawiam takich irracjonalnych dywagacji pozbawionych odstaw empirycznych.

Cytat:
a ID dopasowuje ideologie do faktow.


to udowodnij, że błędy nie są cechą projektu

Cytat:
Cytat:
Wogóle nic nie mówi o demiurgu, bo dotyczy wyłącznie przyrody ożywionej


A gdzie Ty w przyrodzie widzisz swojego demiurga.


nie widzę i dlatego lubie hipoteze ID, która nic o nim nie mówi


Cytat:
Powiedz to sie tym Noblem podzialkujemy :D



to Ty i anbo juz i tak za dużo nagadaliście sie na temat demiurga

nie zamierzam partycypować w tym waszym noblu
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Wto 15:23, 14 Mar 2006    Temat postu:

Do motek-

Czy aby nie probujesz udowodnic istnienia Niedoskonalego Projektu W Przyrodzie powolujac sie na niedoskonaly projekt w owej przyrodzie :D

Cytat:
W oparciu o empirę analizuje cechy projektów i porównuje je z cechami organizmów żywych. Dostrzegam mnóstwo podobieństw.
Nie dostrzegam natomiast istotnych podobieństw między materią zywa, a wytworami procesów samoczynnych i niekierowanych.


Mozesz temat poszerzyc...Chetnie podyskutuje na gruncie biologii ,a postulaty ID mnie zawsze bawily.




Cytat:
na razie Ty i anbo snujecie kompletnie nieweryfikowalne spekulacje na temat róznych typów demiurgów.


Ja o zadnych demiurgach nie gadam bo o czyms takim jak demiurg dowiedzialem sie dopiero od Ciebie ,a wiec to Ty postulujesz tutaj jakies demiurgi nie ja. Zamotales sie motek.


a ID dopasowuje ideologie do faktow.

Cytat:
to udowodnij, że błędy nie są cechą projektu


Chyba Cie facet demiurg opuscil, ja mam Ci udowadniac, ze krasnoludki nie sikaja do mleka... :D :D :D

Ja Ci moge pokazac co nauka na ten temat mowi. Przeprowadzono symulacje ewolucji oka. Zanim symulacja doprowadzila do wyewoluowania takiego oka jak maja ryby, po drodze powstawaly rozne warianty, a wtym niedoskonala odwrocona siatkowka. Pokaz mi chc przeslanke tej wagi przemawiajaca za istnieniem Nieinteligentnego Projektu W Przyrodzie ,a pogadamy. Co ponadto to jalowizna intelektualna.

Cytat:
Wogóle nic nie mówi o demiurgu, bo dotyczy wyłącznie przyrody ożywionej


A gdzie Ty w przyrodzie widzisz swojego demiurga.

Cytat:
nie widzę i dlatego lubie hipoteze ID, która nic o nim nie mówi


Za co ja lubisz za to ,ze nie generuje w sobie zadnych informacji. Pojecie hipoteza ID jest intelektualnie pusta. To tak jakbyc powiedzial hipoteza dobrych wrozek.


pzdr.


Ostatnio zmieniony przez maynard dnia Wto 16:50, 14 Mar 2006, w całości zmieniany 1 raz
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Wto 15:28, 14 Mar 2006    Temat postu:

Ks.Marek napisał:
maynard napisał:
Na katolikach wlasnie o tym obrzydliwym typie dyskutowalem


Takie pisanie czy tez mowienie dyskfalifikuje Cie jako oponenta w dysusji. Odsłaniasz sie maynardzie w wąskości swojego myślenia. To nienaukowe i nieprofesjonalne podejscie do tematu - no, chyba ze jakos racjonalnie wykazesz obrzydliwosc De Chardina.


Najpierw pokaz naukowosc swojego Teilharda a pozniej utyskuj na moja. Ja ze swojej strony wykazalem IDiotyzm tego Twojego Teilharda.


pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
motek




Dołączył: 07 Mar 2006
Posty: 565
Przeczytał: 0 tematów

Skąd: Wrocław

PostWysłany: Wto 16:22, 14 Mar 2006    Temat postu:

maynard napisał:
Cytat:
W oparciu o empirę analizuje cechy projektów i porównuje je z cechami organizmów żywych. Dostrzegam mnóstwo podobieństw.
Nie dostrzegam natomiast istotnych podobieństw między materią zywa, a wytworami procesów samoczynnych i niekierowanych.


Mozesz temat poszerzyc...Chetnie podyskutuje na gruncie biologii ,a postulaty ID mnie zawsze bawily.

mogę

żebyś nie zarzucał mi jakiejś manipulacji, to na początek Ty sam zaproponuj przykłady typowych obiektów należących do:
a/ przyrody nieżywionej
b/ przyrody ożywionej
c/ wytworu ludzkiej inteligencji

potem dokonamy porównania ich cech. OK?




Cytat:
Cytat:
na razie Ty i anbo snujecie kompletnie nieweryfikowalne spekulacje na temat róznych typów demiurgów.


Ja o zadnych demiurgach nie gadam bo o czyms takim jak demiurg dowiedzialem sie dopiero od Ciebie ,a wiec to Ty postulujesz tutaj jakies demiurgi nie ja.
demurg to synonim słowa kreator, stwórca

bądź łaskwa zauważyć, że wszdełsy do tek dyskusji (Pią 17:07, 10 Mar 2006) ani razu nie uzyłem żadnego z tych słów

w odpowiedzi na tem post
najpierw anbo napisał:
Z kim Bóg musiał zawierać kompromis?
(...)
Co Boga ogranicza?
potem z klei maynard napisał:
niektorzy teisci gotowi sa ograniczyc funkcje uzytecznosci Kreatora
(...)
tylko co na to Stworca rzeczy widzialnych i niewidzialnych


Więc to anbo wprowdził pojęcie Boga, a Ty wprowadziłeś pojęcie kretora i stwórcy. A kto uzył słowa "kreator" w tytule wątku? krasnoludki, czy wrózki? :)

Ja uzyłem słowa demiurg tylko po to, by wyrazić niechęć do dyskusji na ten temat



Cytat:
a ID dopasowuje ideologie do faktow.


a niby jaką ideologię?

Cytat:
Cytat:
to udowodnij, że błędy nie są cechą projektu


Chyba Cie facet demiurg opuscil, ja mam Ci udowadniac, ze krasnoludki nie sikaja do mleka... :D :D :D


nie

Oczekuję, że udowodnisz , iż projekt to coś, co nie zawiera błędów. Weź po prostu dowolny przykład obiektu zaprojektowanego (np. mieszkanie, rower, telefon, dziurkacz) i sprawdź, czy ma on jakieś błędy, czy nie.

Albo odwrotnie - weż jakiś obiekt który ma kika błędów i udowodnij, że jest on wytworem samoistnych i niecelowych procesów.

Albo jeszcze inaczej. Wez obiekt, który powstał samoistnie (np. piorun, kamień, wirek w wannie, wiatr) i wykaż, że posiada on jakies błędy.


W ten sposób sie przekonamy, czy fakt iż obiekt posiada błedy przesądza o tym, że nie został zaprojektowany, tylko powstał samoistnie.


Cytat:
Pokaz mi chc przeslanke tej wagi przemawiajaca za istnieniem Nieinteligentnego Projektu W Przyrodzie ,a pogadamy.


W kwestii formalnej: ja optuję za inteligentnym projektem. Pamiętaj ponadto, że przymiotniki takie jak: głupota czy nieudolność, opisują inteligencję. Nikt nie powie przeciez, że kamien jest nieudolny, a np. chmura jest głupia. Tymi przymiotnikami opisuje się wyącznie obiekty posiadające inteligencję.


a teraz
weż obiekt na pewno inteligentnie zaprojektowany: np. wiatrak
weż obiekt na pewno powstały samoczynnie: np. meteoryt

a teraz weź jakiś organizm żywy, np. ślimaka i powiedz, z którym z powyższych obiektów ma on więcej cech wspólnych, a jakie cechy je odrózniają

ta propozycja to czysta empiria i racjionalizm - żadnych demiurgów, zadnych ideologii, adnych bytów niepotrzebnych, żadnych wstępnych założeń. Więc nie powinienes sie obawiać takiej analizy.


Cytat:
Co ponadto to jalowizna intelektualna.


stosując inwektywy zdradzasz słabość


Cytat:
Cytat:
nie widzę i dlatego lubie hipoteze ID, która nic o nim nie mówi


Za co ja lubisz za to ,ze nie generuje w sobie zadnych informacji. Pojecie hipoteza ID jest intelektualnie pusta.


Informacja, że przyroda ożywiona jest zaplanowana, moze miec istotne konsekwencje. Tak samo istotne jak te, które daje nam ewolucjonizm.



Cytat:
To tak jakbyś powiedzial hipoteza dobrych wrozek.


nie

ID nie postuluje istnienia jakichś nieznanych obiektów. Jedynie zwraca uwagę na istnienia pewnych cech u obiektów, które doskonale znamy z empirycznych obserwacji.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Wto 16:40, 14 Mar 2006    Temat postu:

do motek-

maynard napisał:
Cytat:
W oparciu o empirę analizuje cechy projektów i porównuje je z cechami organizmów żywych. Dostrzegam mnóstwo podobieństw.
Nie dostrzegam natomiast istotnych podobieństw między materią zywa, a wytworami procesów samoczynnych i niekierowanych.


Mozesz temat poszerzyc...Chetnie podyskutuje na gruncie biologii ,a postulaty ID mnie zawsze bawily.

Cytat:
mogę


Cytat:
żebyś nie zarzucał mi jakiejś manipulacji, to na początek Ty sam zaproponuj przykłady typowych obiektów należących do:
a/ przyrody nieżywionej
b/ przyrody ożywionej
c/ wytworu ludzkiej inteligencji

potem dokonamy porównania ich cech. OK?


Sluchaj koles nie zabawiaj sie zemna w kotka i myszke tylko dawaj przyklad swiadczacy o yntelygentnym/nieyntelygentnym projekscie. To Ty postulujesz yntelygentny/nieyntelygentny projekt w przyrodzie i Twoja brocha w wykazaniu tego gdzie on rzekomo lezy




Cytat:
na razie Ty i anbo snujecie kompletnie nieweryfikowalne spekulacje na temat róznych typów demiurgów.

Ja o zadnych demiurgach nie gadam bo o czyms takim jak demiurg dowiedzialem sie dopiero od Ciebie ,a wiec to Ty postulujesz tutaj jakies demiurgi nie ja.


Cytat:
demurg to synonim słowa kreator, stwórca


Cytat:
bądź łaskwa zauważyć, że wszdełsy do tek dyskusji (Pią 17:07, 10 Mar 2006) ani razu nie uzyłem żadnego z tych słów

w odpowiedzi na tem post[quote="najpierw anbo"]Z kim Bóg musiał zawierać kompromis?
(...)
Co Boga ogranicza?[/

potem z klei maynard napisał:
niektorzy teisci gotowi sa ograniczyc funkcje uzytecznosci Kreatora
(...)
tylko co na to Stworca rzeczy widzialnych i niewidzialnych


Cytat:
Więc to anbo wprowdził pojęcie Boga, a Ty wprowadziłeś pojęcie kretora i stwórcy. A kto uzył słowa "kreator" w tytule wątku? krasnoludki, czy wrózki? :)


Ja wprowadzilem to pojecie na uzytek ilustracji bezsensu waszej argumentacji za istnieniem owego Kreatora. Ty natomist postulujesz jawnie-choc posrednio- jego istnienie. No chyba ,ze uwazasz, iz Twoj yntelygentny/nieyntelygentny projekt powstal bez udzialu yntelygentnego/nieyntelygentnego projektanta. Szczerze mowiac to wcale mnie takie stanowisko nie zdziwi , zdazylem sie juz przyzwyczaic do kreacjonistycznej logiki. Dwoch takich to mi nawet wmawialo ,ze mozna przeprowadzic dowod bez wczesniejszych zalozen :D


pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
motek




Dołączył: 07 Mar 2006
Posty: 565
Przeczytał: 0 tematów

Skąd: Wrocław

PostWysłany: Wto 17:05, 14 Mar 2006    Temat postu:

maynard napisał:
Sluchaj koles nie zabawiaj sie zemna w kotka i myszke tylko dawaj przyklad swiadczacy o yntelygentnym/nieyntelygentnym projekscie. To Ty postulujesz yntelygentny/nieyntelygentny projekt w przyrodzie i Twoja brocha w wykazaniu tego gdzie on rzekomo lezy


a gdzie w komputerze leży inteligentny projekt?

on JEST ID, a nie ID "w nim leży"

Organizmy zywe, jak sama nazwa wskazuje sa ZORGANIZWANE, a organizacja zawsze jest wytworem celowego i planowego działania. Ty dla obalenia ID stwierdzasz, że sa zorganizowane błędnie. Niech Ci będzie. Jednak nadal są zorganizowane.



Cytat:
Cytat:
Więc to anbo wprowdził pojęcie Boga, a Ty wprowadziłeś pojęcie kretora i stwórcy. A kto uzył słowa "kreator" w tytule wątku? krasnoludki, czy wrózki? :)


Ja wprowadzilem to pojecie na uzytek ilustracji bezsensu waszej argumentacji za istnieniem owego Kreatora.


a ja kategorycznie odmawiam dywagacji na ten temat


Cytat:
Ty natomist postulujesz jawnie-choc posrednio- jego istnienie. No chyba ,ze uwazasz, iz Twoj yntelygentny/nieyntelygentny projekt powstal bez udzialu yntelygentnego/nieyntelygentnego projektanta. Szczerze mowiac to wcale mnie takie stanowisko nie zdziwi , zdazylem sie juz przyzwyczaic do kreacjonistycznej logiki.


bynajmniej -jeśli jest projekt, to istnieje jakiś projektant

jednak Ty, choć postulujesz, że ów projektant NIE ISTNIEJE, to jednak usilnie zakładasz, że ma on pewne precyzyjnie określone przez ciebie cechy.

Wybacz, ale jeśli nie istnieje, to nie moze miec żadnych cech - no chyba, że wedle ewolucjonistycznej logiki :)


Założenie istnienia projektanta nie jest irracjonalne.
Gdyby tak było, to np. archeolog, który znalazł kurchan, albo narzędzie z kości, musiałby wyjaśnić pochodzenie kurchanu erozją lub, górotworem, a pochodzenie narzędzia z kości specyficznym sposobem obgryzania jej przez psa.

I dopiero to byłoby irracjonalne!
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
maynard




Dołączył: 06 Lut 2006
Posty: 335
Przeczytał: 0 tematów

Skąd: szczecin

PostWysłany: Wto 17:39, 14 Mar 2006    Temat postu:

motek-
Sluchaj koles nie zabawiaj sie zemna w kotka i myszke tylko dawaj przyklad swiadczacy o yntelygentnym/nieyntelygentnym projekscie. To Ty postulujesz yntelygentny/nieyntelygentny projekt w przyrodzie i Twoja brocha w wykazaniu tego gdzie on rzekomo lezy

Cytat:
a gdzie w komputerze leży inteligentny projekt?

on JEST ID, a nie ID "w nim leży"


Dobra dobra gdzie w komputerze lezy slad ID to ja wiem ,pokaz gdzie lezy w biologii.

Cytat:
Organizmy zywe, jak sama nazwa wskazuje sa ZORGANIZWANE, a organizacja zawsze jest wytworem celowego i planowego działania. Ty dla obalenia ID stwierdzasz, że sa zorganizowane błędnie. Niech Ci będzie. Jednak nadal są zorganizowane.


Nie ma tu zadnej analogii z komputerem. Nieozywione wytwory ludzkiej techniki to co innego niz organizmy zywe. Komputery sie nie rozmnazaja nie mutuja i nie ewoluuja, jesli by tak bylo to komputery powstawalby na drodze ewolucji. I na koniec: Paleyowski argument z inteligentnego projektu juz nie funkcjinuje. Nie funkcjonuje od czasow Darwina, jako przekonanie, a od czasow Simpsona i Maira jako fakt naukowy. Wiec sobie daruj te teologiczne dywagacje i jak chcesz zemna gadac to wkraczaj na twardy poznawczy grunt nauk empirycznych.

pzdr.
Powrót do góry
Zobacz profil autora
Wyświetl posty z ostatnich:   
Napisz nowy temat   Odpowiedz do tematu    Forum ŚFiNiA Strona Główna -> Genesis Wszystkie czasy w strefie EET (Europa)
Idź do strony Poprzedni  1, 2, 3, 4  Następny
Strona 3 z 4

 
Skocz do:  
Nie możesz pisać nowych tematów
Nie możesz odpowiadać w tematach
Nie możesz zmieniać swoich postów
Nie możesz usuwać swoich postów
Nie możesz głosować w ankietach

fora.pl - załóż własne forum dyskusyjne za darmo
Powered by phpBB © 2001, 2005 phpBB Group
Regulamin