Forum ŚFiNiA Strona Główna ŚFiNiA
ŚFiNiA - Światopoglądowe, Filozoficzne, Naukowe i Artystyczne forum - bez cenzury, regulamin promuje racjonalną i rzeczową dyskusję i ułatwia ucinanie demagogii. Forum założone przez Wuja Zbója.
 
 FAQFAQ   SzukajSzukaj   UżytkownicyUżytkownicy   GrupyGrupy   GalerieGalerie   RejestracjaRejestracja 
 ProfilProfil   Zaloguj się, by sprawdzić wiadomościZaloguj się, by sprawdzić wiadomości   ZalogujZaloguj 

Dowod, ze IP nie jest w stanie zaprzeczyc TE
Idź do strony Poprzedni  1, 2, 3, 4, 5, 6  Następny
 
Napisz nowy temat   Odpowiedz do tematu    Forum ŚFiNiA Strona Główna -> Genesis
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
crush




Dołączył: 17 Mar 2006
Posty: 312
Przeczytał: 0 tematów

Skąd: Górny Śląsk

PostWysłany: Śro 21:19, 16 Maj 2007    Temat postu:

wujzboj napisał:
Jesli (...) rozumiesz koncepcje Behego na tyle, by w ogole zajmowac sie analizowaniem dowodu pokazujacego blednosc tej koncepcji, to mozesz tylko albo zgadzac sie z tym podsumowaniem, albo sie z nim nie zgadzac.

Czekam wiec wciaz na twoja opinie na temat pierwszego zdania. Czy zawarte w nim podsumowanie koncepcji Behego jest wedlug ciebie prawidlowe, cz nie?


Wuju, perełko, Twoje "podsumowanie" koncepcji Behego jest mi w dalszym ciągu obojętne. Czekam na Twój dowód "kładący" koncepcję Behego a nie wujazboja podsumowanie koncepcji Behego, o ile, oczywiście, rozumiesz koncepcję Behego na tyle aby w ogóle zajmować się udowadnianiem jej błędności.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Czw 0:24, 17 Maj 2007    Temat postu:

To jest rozkoszne, crush. Jak sobie wyobrazasz rozmowe na temat czegos, co nie zostalo na poczatku USTALONE?

Czy moglbys wyartykulowac powod, dla ktorego unikasz ustalenia od samego poczatku, ze obaj identycznie rozumiemy przedmiot dyskusji?
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
crush




Dołączył: 17 Mar 2006
Posty: 312
Przeczytał: 0 tematów

Skąd: Górny Śląsk

PostWysłany: Czw 21:39, 17 Maj 2007    Temat postu:

wujzboj napisał:
To jest rozkoszne, crush. Jak sobie wyobrazasz rozmowe na temat czegos, co nie zostalo na poczatku USTALONE?

Zostało USTALONE ! Mieliśmy rozmawiać na temat Twojej argumentacji obalającej koncepcję Behego. Przedstaw ją to pogadamy.

wujzboj napisał:
Czy moglbys wyartykulowac powod, dla ktorego unikasz ustalenia od samego poczatku, ze obaj identycznie rozumiemy przedmiot dyskusji?

Nie mogę rozumieć czegoś czego nie znam (patrz wyżej). Jak przedstawisz dowód "kładący" koncepcję Behego to go zrozumiem albo nie zrozumiem. Póki co, czekam.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Pią 16:18, 25 Maj 2007    Temat postu:

Crush, czy znasz koncepcję Behego?
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
crush




Dołączył: 17 Mar 2006
Posty: 312
Przeczytał: 0 tematów

Skąd: Górny Śląsk

PostWysłany: Sob 21:48, 02 Cze 2007    Temat postu:

Wujuzboju, czekam na dowód. Sam wiesz jaki.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Pon 18:01, 04 Cze 2007    Temat postu:

Dowod masz w pierwszym poscie tego watku.

Prosze wez sie za powazna rozmowe na jego temat. A jesli nie potrafisz, to daj spokoj.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
crush




Dołączył: 17 Mar 2006
Posty: 312
Przeczytał: 0 tematów

Skąd: Górny Śląsk

PostWysłany: Nie 19:28, 10 Cze 2007    Temat postu:

wujzboj napisał:
Dowod masz w pierwszym poscie tego watku.

Tak, tak - pamiętam. Ponieważ nie chcesz zdradzić, w którym zdaniu owego postu jest ukryty przedmiotowy dowód lecimy po kolei.

Z dotychczasowej rozmowy wnioskuję, że pierwsze zdanie nie zawiera dowodu. Przejdźmy więc do drugiego zdania.
wujzboj napisał:
Kwestia ta zajmowalismy sie dluzszy czas w watku ks. prof. Michał Heller - Bóg, konieczność i przypadek mniej wiecej od postu Bóg, konieczność i przypadek. Dyskusja dotykala roznych aspektow zagadnienia; tu chcialbym jednak podkreslic rzecz podstawowa: fakt, ze kryterium Behego jest po prostu bledne.


Czyżby poszukiwanym dowodem było stwierdzenie :" kryterium Behego jest po prostu bledne "?
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Wto 22:10, 12 Cze 2007    Temat postu:

Ty mi sie nie spiesz. Jesli nie rozumiesz dosc trywialnego pierwszego zdania, bedacego prostym sformulowaniem twierdzenia Behego, to jak mozesz rozumiec cala reszte?

Jesli znasz twierdzenie Behego, to przeczytaj raz jeszcze pierwsze zdanie i powiedz, czy zdanie to prawidlowo oddaje twierdzenie Behego, czy nie. A jesli tego nie potrafisz, to na poczatku dowiedz sie skads, na czym to twierdzenie polega. Jak bedziesz juz wiedzial i jak bedziesz umial porownac twoja wiedze na ten temat z owym pierwszym zdaniem, to wrocisz i odpowiesz na moje pytanie.

Przypomne, ze pierwsze zdanie brzmi:

Wedlug Behego, jesli jakis uklad jest zlozony do tego stopnia, ze usuniecie z niego jakiegos elementu niszczy funkcjonalnosc tego ukladu, to uklad ten nie mogl powstac na drodze ewolucji; uklad taki jest nazywany przez Behego "projektem", jako ze - zdaniem Behego - jego istnienie wskazuje na istnienie jakiegos inteligentnego projektanta, ktory ten uklad zaprojektowal.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
crush




Dołączył: 17 Mar 2006
Posty: 312
Przeczytał: 0 tematów

Skąd: Górny Śląsk

PostWysłany: Pon 21:12, 18 Cze 2007    Temat postu:

wujzboj napisał:
Ty mi sie nie spiesz. Jesli nie rozumiesz dosc trywialnego pierwszego zdania, bedacego prostym sformulowaniem twierdzenia Behego, to jak mozesz rozumiec cala reszte?
Wszystko jasne.
W drugim zdaniu dowodu nie ma. Przejdźmy do trzeciego zdania:
wujzboj napisał:
Aby w ogole dyskutowac o teorii IP (inteligentnego projektu), nalezy uprzednio wykazac, ze ponizszy dowod jest bledny...

Ja w tym zdaniu rzeczonego dowodu nie widzę ale mogę się mylić. Czekam na werdykt wujazboja.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Pią 0:15, 22 Cze 2007    Temat postu:

Ty szukasz zdania z dowodem? :rotfl:

Dowodu nie ma W ZDANIU, crush :D. Dowod to ROZUMOWANIE :D. Choć na razie wygląda na to, że nie wiesz, co to dowód, to mam nadzieje, ze uda ci sie to z czasem pojąć. Być może podczas tej rozmowy. Nie spieszmy sie wiec, bo idzie o rzecz ważniejszą, niż jakieś tam kryterium. Idzie o zrozumienie, czym jest dowód.

Aby sformulować dowód, trzeba najpierw przedstawić twierdzenie, które się będzie dowodziło. W tym przypadku chodzi o twierdzenie mówiące, że kryterium Behego nie spełnia swojego zadania. Trzeba więc zacząć od przedstawienia kryterium Behego i zadania, jakie ma ono spełniać. To jest rola początkowych zdań.

Czy zrozumiales juz pierwsze zdanie? TAK czy NIE?

Czy zgadzasz sie, pierwsze zdanie prawidlowo oddaje teze Behego? TAK CZY NIE?
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
crush




Dołączył: 17 Mar 2006
Posty: 312
Przeczytał: 0 tematów

Skąd: Górny Śląsk

PostWysłany: Pon 18:15, 25 Cze 2007    Temat postu:

wujzboj napisał:
Ty szukasz zdania z dowodem? :rotfl:

Dowodu nie ma W ZDANIU

Wot, żartowniś z wujaszka !

Dowodu nie ma w zdaniu, w pierwszym poście są tylko zdania ergo dowodu nie ma w pierwszym poście :grin:

Ja wiedziałem, że tak będzie ! Że wujaszek tak sie tylko ze mną droczy.


Cytat:
crush :D. Dowod to ROZUMOWANIE :D.

Tak??? :shock:
Słownik języka polskiego PWN mówi, że dowód to: skończony ciąg zdań uzasadniający prawdziwość danego twierdzenia.

Z czego wynika jasno, że jeśli zdania pierwszego postu nie zawierają dowodu (co wujzboj potwierdza) to go tam, po prostu, nie ma.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Wto 23:09, 03 Lip 2007    Temat postu:

W tej sytuacji moze po prostu sprobujemy cos udowodnic, OK? Cos prostego ale nie do konca trywialnego. Tak, zeby bylo widac, jak dziala dowod.

Najpierw musimy ustalic, CO udowadniamy. Pierwsze zdanie nie jest wiec dowodem, lecz postawieniem problemu. Prawda?

Niech tym problemem bedzie twierdzenie, ze suma kwadratow dwoch liczb dodatnich jest mniejsza od kwadratu sumy tych liczb.

Pierwsze pytanie: czy rozumiesz to niebieskie zdanie? (Pytanie jest wazne, bo aby cos udowodnic, trzeba rozumiec postawiony problem.)

Drugie pytanie: czy to niebieskie zdanie zawiera jakis dowod?
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
crush




Dołączył: 17 Mar 2006
Posty: 312
Przeczytał: 0 tematów

Skąd: Górny Śląsk

PostWysłany: Sob 23:22, 21 Lip 2007    Temat postu:

wujzboj napisał:
W tej sytuacji moze po prostu sprobujemy cos udowodnic, OK?

OK, ale nie "my" tylko wuj i nie "coś" tylko, że koncepcja Behego jest do d...
Czekam cierpliwie.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Wto 23:42, 07 Sie 2007    Temat postu:

Czyli zrezygnowałeś z próby dyskusji? OK. Pa-pa :D.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
crush




Dołączył: 17 Mar 2006
Posty: 312
Przeczytał: 0 tematów

Skąd: Górny Śląsk

PostWysłany: Nie 10:57, 30 Wrz 2007    Temat postu:

wujzboj napisał:
Czyli zrezygnowałeś z próby dyskusji? OK. Pa-pa :D.

Póki co nie ma o czym dyskutować - nie przedstawiłeś dowodu.
Będzie o czym to podyskutujemy.
Czekam.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
wujzboj
Bloger na Kretowisku



Dołączył: 29 Lis 2005
Posty: 22564
Przeczytał: 9 tematów

Skąd: znad Odry
Płeć: Mężczyzna

PostWysłany: Wto 0:30, 09 Paź 2007    Temat postu:

Dowód jest w pierwszym poście tego wątku.

A w naszej rozmowie na razie stanęliśmy na tym, że nie wiesz, co to w ogóle jest "dowód". Nic więc dziwnego, że dowodu tam znaleźć nie umiesz. Skoro bowiem nie wiesz, czego szukać... :rotfl:
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
monitor/konto_usuniete
Usunięcie na własną prośbę



Dołączył: 08 Lut 2008
Posty: 656
Przeczytał: 0 tematów

Skąd: Konto usunięte na prośbę użytkownika. Patrz: przycisk WWW

PostWysłany: Czw 19:38, 14 Lut 2008    Temat postu: Re: Dowod, ze IP nie jest w stanie zaprzeczyc TE

wujzboj napisał:
....... Zauwaz, ze poniewaz w calym tym procesie nie wystepuje optymalizacja ukladow takich jak uklad A3|~B3|C3|D3 uzyskany z ukladu A3|B3|C3|D3 po usunieciu elementu B3, to nalezy sie spodziewac, ze f(A3|~B3|C3|D3) jest duzo, duzo mniejsza od f( A3|B3|C3|D3). Innymi slowy, uklad jest formalnie "nieredukowalnie zlozony", chociaz wyewoluowal!

Na tym polega (kladaca) krytyka argumentu Behego. Krytyka ta jest ilustrowana omawianym dlugo i namietnie przez nas obok przykladem pulapki na myszy.


Szczerze mówiąc nie rozumiem tego wujowego przykładu ,mającego rzekomo w sposób analogiczny udowadniać,że układy nieredukowalne mogły ewoluować w sposób darwinowski. Mnie osobiście przekonałyby przykłady rzeczywiste, tj. oparte o biochemie,a takich jeszcze nikt nie widział. Widzę ,że argument o nieredukowalnym rdzeniu był już tutaj przytaczany, więc nie będę go szerzej prezentował. Podam jednak przykład dobrze obrazujący fakt istnienia nieredukowalnego rdzenia. Chodzi o tzw. genom minimalny, który uzyskali uczeni z Venterem na czele w swoich doświadczeniach. Otóż wycinali oni coraz większe fragmenty genomu u bakterii Mycoplasma genitalium.W ten sposób uzyskali organizm z genomem liczącym 13000 pz., co daje jakieś sto genów. Oczywiście takie minimalne życie może egzystować tylko na specjalnych pożywkach-podłożu-przygotowanych przez naukowców, w warunkach naturalnych byłyby skazane na zagładę (warto dodać,że organizmy z podobnie małymi genomami,a występujące w środowiskach naturalnych są zdolne do życia tylko dlatego, iż współżyją jako symbionty z bardziej skomplikowanymi/autonomicznymi organizmami, lub jako pasożyty innych organizmów). Warto tu zadać pytanie: czy zredukowana do minimum komórka może powstać sama? A jak nie może, to czy można sobie wyobrazić wcześniejszego prekursora (protobionta), który byłby w stanie powstać spontanicznie (oczywiście warto tu wspomnieć o hipotezie Swiata RNA. Kiedyś uważano,że produkt tego świata-pierwotny prekursor zwany "ryboorganizmem" mógł dać początek dzisiejszemu życiu. Dzisiaj się uważa inaczej: " Prostsze początki życia, Robert Shaphiro [link widoczny dla zalogowanych] Nagłe pojawienie się dużych samokopiujących się cząsteczek, takich jak RNA, jest niemal niemożliwe. Życie powstało raczej jako sieć wzajemnie oddziałujących małych cząsteczek, sterowana przepływem energii."). Na koniec pokaże coś,co mało kto sobie uświadamia. Jeżeli ktoś jest w stanie przyjąć,że minimalne życie może wyewoluować samo, to ten genom wygląda tak jak prezentuje poniżej (jest niemożliwe żeby czysty przypadek poukładał taką informacje z losowo wymieszanych nukleotydów). Oczywiście powinienem jeszcze ująć w tym poglądowym schemacie białka niezbędne do życia (trzeba podkreślić,iż funkcjonujące proteiny muszą się składać coś z ponad siedemdziesięciu aminokwasów, o ścisłej sekwencji, poniżej tej granicznej białko traci swoją strukturę przestrzenną (konformacje). Białka występujące w żywych organizmach muszą zachować biochemiczną różnorodność, aby prawidłowo spełniać swoje obowiązki katalityczne. Więc przeciętna komórka-od której miałoby wystartować życie musiałaby się składać z białek ,w których skład wchodziłoby przeciętnie jakieś dwieście aminokwasów! Poza tym sto genów z genomu minimalnego, nie oznacza stu białek! Białka w żywej komórce występują w wielu niezbędnych kopiach, które musiałby pojawić się od razu podczas spontanicznej syntezy pierwszej komórki! Dajmy na to białka wchodzące w skład rybosomów, tworzące polimerazy, białka błonowe i różne inne enzymy szlaków metabolicznych).


GENOM MINIMALNY:

ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT


GTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT
ACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGTACGTAACCGTGCTACGTCGT

pzdr.


Ostatnio zmieniony przez monitor/konto_usuniete dnia Pią 2:58, 15 Lut 2008, w całości zmieniany 7 razy
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
anbo




Dołączył: 09 Lut 2006
Posty: 3519
Przeczytał: 46 tematów


PostWysłany: Czw 21:02, 14 Lut 2008    Temat postu:

Monitor, Venton czy Venter? Coś tam słyszałeś, ale wygląda na to, ze niedokładnie. Zespół z Venter institute chcial sprawdzić która setka genów Mycoplasma genitalium nie jest konieczna do funkcjonowania komórki. Czy dobrze cię rozumiem, ze według ciebie wycinanie genów jest redukowaniem złożoności, czyli odwrotnością procesu pojawiania się złożoności w drodze ewolucji? Chcesz w ten sposób pokazać, że złożonośc zdolna do samodzielnego życia jest tak duża, że nie mogła się pojawić spontanicznie? Pytam, bo nie wiem za bardzo jak chcesz doświadczenie zespołu z Venter institute przykleić do argumentu nieredukowalnej złożoności.

Ostatnio zmieniony przez anbo dnia Czw 21:04, 14 Lut 2008, w całości zmieniany 1 raz
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
monitor/konto_usuniete
Usunięcie na własną prośbę



Dołączył: 08 Lut 2008
Posty: 656
Przeczytał: 0 tematów

Skąd: Konto usunięte na prośbę użytkownika. Patrz: przycisk WWW

PostWysłany: Czw 23:59, 14 Lut 2008    Temat postu:

Cytat:
Monitor, Venton czy Venter?


Przepraszam już poprawiłem.


Cytat:

Coś tam słyszałeś, ale wygląda na to, ze niedokładnie.


Więcej od Ciebie.
A poza tym mógłbyś sobie darować te nieuzasadnione uwagi. Nie wiem dlaczego moderatorzy nie reagują na te Twoje personalne wycieczki,ale widać "stare świnie" są tu szczególnie traktowane i światopogląd nie ma tu żadnego znaczenia.

Cytat:

Zespół z Venter institute chcial sprawdzić która setka genów Mycoplasma genitalium nie jest konieczna do funkcjonowania komórki.


O tym pisałem. Ja bym to sformułował bardziej adekwatnie :"chcieli sprawdzić jaka minimalna ilość genów jest potrzebna do funkcjonowania żywej komórki,w tym przypadku za tester posłużyła ta bakteria.

Cytat:
Czy dobrze cię rozumiem, ze według ciebie wycinanie genów jest redukowaniem złożoności, czyli odwrotnością procesu pojawiania się złożoności w drodze ewolucji?


Tak jest redukowaniem złożoności, z tym że nie odwrotnością. Przynajmniej nikt tego nie udowodnił, ponieważ w naturalnych warunkach ta bakteria potrzebuje tyle genów, ile było przed zredukowaniem.

Cytat:
Chcesz w ten sposób pokazać, że złożonośc zdolna do samodzielnego życia jest tak duża, że nie mogła się pojawić spontanicznie?


Tak chcę to pokazać.

Cytat:


Pytam, bo nie wiem za bardzo jak chcesz doświadczenie zespołu z Venter institute przykleić do argumentu nieredukowalnej złożoności.



W ten sposób ,że ten eksperyment wykazał istnienie czegoś,co się nazywa "nieredukowalnym rdzeniem" i to, co pokazał już Michael Behe: że redundancja nie stoi w sprzeczności z teorią nieredukowalnej złożoności.

[link widoczny dla zalogowanych]
Cytat:
Nie należy też pochopnie wnioskować o redukowalności systemów
posiadających dodatkowe, czyli redundantne składniki, mogą one
bowiem posiadać nieredukowalnie złożony rdzeń. Na przykład, samo-
chód z czterema świecami zapłonowymi może jeździć z trzema lub
dwiema świecami, lecz z pewnością nie pojedzie bez żadnej. Pułapki
na szczury mają często dwie sprężyny w celu zwiększenia ich siły.
Taka pułapka może działać po usunięciu jednej sprężyny, ale nie
będzie działała, gdy usunie się dwie. Przy próbie wyobrażenia sobie
powstania pułapki na szczury za pomocą środków darwinowskich
nadal natrafiamy na wszystkie problemy, które mieliśmy z pułapką na myszy. Przykładem redundancji w komórce jest ogromnie złożona
rzęska eukariotyczna, składająca się z około 250 różnych części
białkowych.
14
Rzęska ma liczne kopie wielu swoich składników, łącz-
nie z dużą ilością mikrotubul i ramion dyneinowych. Jednak, jak
przedstawiłem w swojej książce,
15
funkcjonująca rzęska potrzebuje do
działania przynajmniej jednej kopii każdego ze składników. Dlatego,
podobnie jak w przypadku pułapki na szczury, trudno sobie wyobra-
zić, jak mogła ona powstać w stopniowym, darwinowskim procesie.
Kenneth Miller wskazuje redundantność rzęski jako kontrprzykład dla
mojego twierdzenia o jej nieredukowalności.
16
Lecz redundantność
powoduje jedynie odłożenie kwestii nieredukowalności na później; nie
eliminuje jej.
W końcu, zamiast pokazać, w jaki sposób ich teoria radzi sobie z
tym problemem, darwiniści starają się obejść problem nieredukowal-
nej złożoności przy pomocy gierek słownych.


pzdr.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
anbo




Dołączył: 09 Lut 2006
Posty: 3519
Przeczytał: 46 tematów


PostWysłany: Pią 9:55, 15 Lut 2008    Temat postu:

1. Uwaga była uzasadniona. Błędnie podałeś nazwisko, nieco wypaczyłeś wskazane przez siebie badania. Może dlatego moderatorzy nie zareagowali?

2. Skoro zmniejszanie ilości genow nie jest odwrotnością ewolucyjnego procesu zwiększania złożoności, to jakim cudem wskazane badania mają dowodzić, że złożoność nie mogła powstać ewolucyjnie?
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
monitor/konto_usuniete
Usunięcie na własną prośbę



Dołączył: 08 Lut 2008
Posty: 656
Przeczytał: 0 tematów

Skąd: Konto usunięte na prośbę użytkownika. Patrz: przycisk WWW

PostWysłany: Pią 16:23, 15 Lut 2008    Temat postu:

anbo napisał:


2. Skoro zmniejszanie ilości genow nie jest odwrotnością ewolucyjnego procesu zwiększania złożoności, to jakim cudem wskazane badania mają dowodzić, że złożoność nie mogła powstać ewolucyjnie?



Złożoność ograniczona do nieredukowalnego rdzenia, reszta ewolucji (elementów redundentnych) jest hipotetycznie możliwa ,lecz nieudowodniona. Czy tak trudno było to pojąć?


No i na koniec-fakt nazwisko przekręciłem, skojarzyło mi się z podobnym,ale nie wykazałem się żadnym niezrozumieniem w temacie oczywiście w przeciwieństwie do Ciebie.

p.


Ostatnio zmieniony przez monitor/konto_usuniete dnia Sob 18:21, 16 Lut 2008, w całości zmieniany 2 razy
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
anbo




Dołączył: 09 Lut 2006
Posty: 3519
Przeczytał: 46 tematów


PostWysłany: Pią 17:31, 15 Lut 2008    Temat postu:

Monitor, 1) co "Złożoność ograniczona do nieredukowalnego rdzenia"? Bo nie dokończyłeś. Ale cokolwiek, to chodzi tu o zasadę; po prostu to doświadczenie z powodu tego, z czym się zgodziłeś, nie dowodzi kreacjonistycznej tezy. Czy to tak trudno zrozumieć?

2) Nie pisałem o "wykazaniu się niezrozumieniem", tylko o tym, że "nieco wypaczyłeś wskazane przez siebie badania". Wciąż przekręcasz; jak w poprzedniej dyskusji.

Sprawa jest w gruncie rzeczy dość prosta. Jeżeli mógł coś zrobić inteligentny kreator, także układ złożony, to mogło to też wyewoluować, o ile było na to dość czasu. Kumulacja przypadkowych zmian może prowadzić do powstania duplikatu dzieła tego inteligentnego kreatora przez to, że wszystko, co przypadkowe, jest możliwe, nawet jeśli jest niezwykle mało prawdopodobne.

Jako ciekawostka:
Behego(!) symulacje numeryczne doboru naturalnego pokazały, że utrwalenie się w populacji bakterii złożonej struktury nastąpiłoby w ciągu 20 000 lat.


Ostatnio zmieniony przez anbo dnia Pią 17:53, 15 Lut 2008, w całości zmieniany 1 raz
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
monitor/konto_usuniete
Usunięcie na własną prośbę



Dołączył: 08 Lut 2008
Posty: 656
Przeczytał: 0 tematów

Skąd: Konto usunięte na prośbę użytkownika. Patrz: przycisk WWW

PostWysłany: Pią 20:20, 15 Lut 2008    Temat postu:

Cytat:
Monitor, 1) co "Złożoność ograniczona do nieredukowalnego rdzenia"? Bo nie dokończyłeś.


Ależ ja dokończyłem i nie zamierzam niczego dodawać. Jasno i krok po kroku wyjaśniłem, a przy tym zacytowałem wyjaśnienia samego Michaela Behego,czego tu jeszcze nie rozumiesz?Myślę,że Ty raczej unikasz merytorycznej dyskusji z tymi argumentami.



Cytat:
tego, z czym się zgodziłeś, nie dowodzi kreacjonistycznej tezy. Czy to tak trudno zrozumieć?


Napisałem z czym się zgodziłem,podkreśliłem też-jasno--z czym się nie zgodziłem. Dobrze by było gdybyś zaczął cytować moje wypowiedzi, wówczas przynajmniej wyszła by na jaw Twoja perfidna retoryka. Dziwi mnie ,że na tym forum nie ma obowiązku cytowania adwersarza????

Cytat:

2) Nie pisałem o "wykazaniu się niezrozumieniem", tylko o tym, że "nieco wypaczyłeś wskazane przez siebie badania". Wciąż przekręcasz; jak w poprzedniej dyskusji.


Niczego nie wypaczyłem Ale jak się nie ma wiedzy w dziedzinie, w której się usiłuje produkować, to najlepiej z dyskutanta zrobić nieuka. Taka jest metoda demagogów. Kolego tak się nie godzi!
Cytat:

Sprawa jest w gruncie rzeczy dość prosta. Jeżeli mógł coś zrobić inteligentny kreator, także układ złożony, to mogło to też wyewoluować, o ile było na to dość czasu.


Póki co nikt nie udowodnił,że czas potrafi czynić cuda. Nie rozumiem też dlaczego w,w sposób nieuprawniony, przyrównujesz inteligentny proces do bezrozumnych procesów ewolucji?

Cytat:

Kumulacja przypadkowych zmian może prowadzić do powstania duplikatu dzieła tego inteligentnego kreatora przez to, że wszystko, co przypadkowe, jest możliwe, nawet jeśli jest niezwykle mało prawdopodobne.



To jest tylko Twoje subiektywne odczucie. Poza tym problem z powstaniem życia,czy nieredukowalnych struktur biologicznych nie ogranicza się tylko do roli nieprawdopodobieństwa ich powstania. Tutaj w grę wchodzi coś bardziej istotnego. Nauka nie potrafi sobie wyobrazić dróg takiej ewolucji,zaprezentować (choćby) możliwego do przyjęcia modelu teoretycznego takiej ewolucji. Nie rozumiem też co masz na myśli pisząc: "Kumulacja przypadkowych zmian może prowadzić do powstania duplikatu dzieła tego inteligentnego kreatora". Nie wiem czy idzie Ci o kumulacje mutacji punktowych,czy duplikacje, na które powołują się ewolucjoniści,żeby wyjaśnić powstanie układów nieredukowalnych. Jeśli tak (mógłbyś się wyrażać bardziej precyzyjnie i w sposób logiczny konstruować zdania?), to Michael Behe obalił (w artykule z, którego cytowałem) i ten argument.

A jeśli Ci chodzi o to,że kumulacja drobnych zmian-stopniowa gradualistyczna ewolucja-ma niby wyjaśniać powstawanie biochemicznych układów nieredukowalnych, to Cię informuje,że stopniowa ewolucja właśnie takiego wyjaśnienia nie daje. I w tym cały sęk. Takie wyjaśnienia są dobre odnośnie skrzydła czy-tutaj już po mocnym naciągnięciu argumentów-oka,ale nie biochemicznych systemów.



Cytat:
Jako ciekawostka:
Behego(!) symulacje numeryczne doboru naturalnego pokazały, że utrwalenie się w populacji bakterii złożonej struktury nastąpiłoby w ciągu 20 000 lat.


Możesz temat rozszerzyć:

-Opisać na czym owa symulacja numeryczna polegała.
-Wykazać w jaki sposób podważa ona koncepcje nieredukowalnej złożoności.

Edit:

Opisze Ci ciekawy przykład. W zakładanej ewolucji eukariotów z prokariotów-co przyznał J.M Smith-nie można sobie wyobrazić sensownych form przejściowych. Bo jak sobie wyobrazić np. przechodzenie chromosomów metafazowych do potomnych komórek, w sytuacji kiedy jeszcze nie wykształciło się zanikanie otoczki jądrowej?

MITOZA:
[link widoczny dla zalogowanych]


pzdr.


Ostatnio zmieniony przez monitor/konto_usuniete dnia Pią 22:08, 15 Lut 2008, w całości zmieniany 6 razy
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
anbo




Dołączył: 09 Lut 2006
Posty: 3519
Przeczytał: 46 tematów


PostWysłany: Pią 23:51, 15 Lut 2008    Temat postu:

1. Monitor, na moje pytanie "jakim cudem wskazane badania mają dowodzić, że złożoność nie mogła powstać ewolucyjnie?", odpowiedziałeś "Złożoność ograniczona do nieredukowalnego rdzenia" - sorry, ale nie ma tu przyklejenia jednego do drugiego. Nie
napisałeś, gdzie widzisz związek. Ustalilismy, że "zmniejszanie ilości genow nie jest odwrotnością ewolucyjnego procesu zwiększania złożoności", a ty w takim właśnie doświadczeniu widzisz dowód, jakby to było odwrócenie procesu.
Na argumenty Behego nie odpowiedziałem, bo 1) nie widzę związku z omawianym przez ciebie doświadczeniem, 2) jest tyle krytycznych omowień argumentacji Behego, że nie ma sensu tego wszystkiego powtarzać.

2. Cytuję, gdy trzeba, chociaż w inny sposób (cytuję w tradycyjny). Nie lubię tutejszego sposobu cytowania, więc robię to po swojemu. Im dalej od omawianego tekstu, tym więcej cytuję. Im bliżej, tym mniejsza koniecznośc.

3. Wypaczenie to chociażby pisanie, że Venter uzyskał genom minimalny, tymczasem jego zespół szukał odpowiedzi na pytanie, ile genów można ująć bakterii, żeby mogła jeszcze żyć, co nie jest tym samym. Drugim wypaczeniem było napisanie, ze "takie minimalne życie może egzystować tylko na specjalnych pożywkach-podłożu-przygotowanych przez naukowców", co sugeruje, że w naturalnych warunkach nie mogłoby żyć, tymczasem nie znamy ani warunkow życia pierwszego replikatora, ani jego budowy, w dodatku Mycoplasma genitalium jest pasożytem, więc hodowanie musi się odbywac na specjalnych podłożach w laboratoriach.

4. To, ze wszystko, co przypadkowe, jest możliwe, nawet jeśli jest niezwykle mało prawdopodobne, to nie moje subiektywne odczucie, tylko fakt matematyczny.
Z kumulacją chodzi o to, że jeśli coś mógł zrobić inteligentny kreator, to mogło to też pojawić się w wyniku przypadkowych zmian nawet jeśli to było bardzo mało prawdopodobne. (Czy w takim razie może być odróżnialne?)

5. Tak sobie myślę, że skoro fakt symulacji Behego omawiano na procesie, w którym zapadł wyrok, ze ID nie może on być częścią nauki, to ma bezpośredni związek z argumentem nieredukowalnej złożoności, którego głównym dawcą jest właśnie Behe, więc wybacz, ze nie odpowiem na twoje pytania. Po prostu wobec tych faktów nie ma potrzeby.

6. Sorry, ale argument z braku wyobraźni J.M. Smitha mnie nie przekonuje. Bardziej mnie przekonuje to, że współczesna genetyka potwierdza, ze eukarioty wyewoluowały z prokariotów.

Sorry, ale to koniec naszego kolejnego spotkania. Zadałem sobie trud i potwierdziło się moje przypuszczenie. Z Behem i innymi argumentami byłes już i w innych miejscach w sieci, także na pl.sci.biologia, tam od fachowców otrzymałeś sprostowania i wyjaśnienia, ale jak zwykle spadły po tobie jak groch po ścianie.
Powrót do góry
Zobacz profil autora
Zobacz poprzedni temat :: Zobacz następny temat  
Autor Wiadomość
monitor/konto_usuniete
Usunięcie na własną prośbę



Dołączył: 08 Lut 2008
Posty: 656
Przeczytał: 0 tematów

Skąd: Konto usunięte na prośbę użytkownika. Patrz: przycisk WWW

PostWysłany: Sob 0:53, 16 Lut 2008    Temat postu:

Cytat:
1. Monitor, na moje pytanie "jakim cudem wskazane badania mają dowodzić, że złożoność nie mogła powstać ewolucyjnie?", odpowiedziałeś "Złożoność ograniczona do nieredukowalnego rdzenia" - sorry, ale nie ma tu przyklejenia jednego do drugiego.


Przecież to proste; osiągnięto pewne maksimum i dalej się nie da.

Cytat:
Ustalilismy, że "zmniejszanie ilości genow nie jest odwrotnością ewolucyjnego procesu zwiększania złożoności", a ty w takim właśnie doświadczeniu widzisz dowód, jakby to było odwrócenie procesu.


Przecież to Ty sugerowałeś ,że ta redukcja dowodzi,że złożoność mogła powstać w odwrotnym procesie stopniowej komplikacji. Jeśli tak nie uważasz to nie jesteś ewolucjonistą:)


Cytat:
Na argumenty Behego nie odpowiedziałem, bo 1) nie widzę związku z omawianym przez ciebie doświadczeniem, 2) jest tyle krytycznych omowień argumentacji Behego, że nie ma sensu tego wszystkiego powtarzać.



No i Behe właśnie z tymi krytycznymi omówieniami dyskutuje i skutecznie odpiera zarzuty. Dlaczego Ty-ani żaden ewolucjonista-nie chcecie podjąć kontrargumentacji?

Cytat:
2. Cytuję, gdy trzeba, chociaż w inny sposób (cytuję w tradycyjny). Nie lubię tutejszego sposobu cytowania, więc robię to po swojemu. Im dalej od omawianego tekstu, tym więcej cytuję. Im bliżej, tym mniejsza koniecznośc.



No i ta anarchia doprowadza to tego,że nie wiesz pózniej co pisałeś i co ja pisałem


Cytat:

3. Wypaczenie to chociażby pisanie, że Venter uzyskał genom minimalny, tymczasem jego zespół szukał odpowiedzi na pytanie, ile genów można ująć bakterii, żeby mogła jeszcze żyć, co nie jest tym samym.


No i właśnie na tym polega robienie genomu (życia) minimalnego .Dr. Trzeciak też jest tego zdania:

[link widoczny dla zalogowanych]
Cytat:

Istnieje koncepcja "minimalnego genomu", ale nie wiadomo, jaka jest ta
minimalna długość, więc twój apel, by "od tego zacząć", jest
przedwczesny. Domyślam się, że twoim zdaniem po ustaleniu wielkości
minimalnego genomu należałoby obliczyć prawdopodobieństwo jego
"samoistnego złożenia z nukleotydów".


Cytat:

Drugim wypaczeniem było napisanie, ze "takie minimalne życie może egzystować tylko na specjalnych pożywkach-podłożu-przygotowanych przez naukowców", co sugeruje, że w naturalnych warunkach nie mogłoby żyć, tymczasem nie znamy ani warunkow życia pierwszego replikatora, ani jego budowy, w dodatku Mycoplasma genitalium jest pasożytem, więc hodowanie musi się odbywac na specjalnych podłożach w laboratoriach.


Fakt środowiska nie znamy, więc należałoby je-choć teoretycznie-ustalić. Pisałem Ci wcześniej ,że organizmy z małymi genomami, to pasożyty,lub symbionty,więc niczego nowego mi nie napisałeś (tu się odbija Twój brak cytowania-nie pamiętasz,co pisał adwersarz). Skoro ten pasożyt nie mógł by przeżyć bez swojego środowiska, lub jego analogu, to co dopiero po tym,jak zredukowano mu genom?

Cytat:
4. To, ze wszystko, co przypadkowe, jest możliwe, nawet jeśli jest niezwykle mało prawdopodobne, to nie moje subiektywne odczucie, tylko fakt matematyczny.


No dobra-skoro dla Ciebie prawdopodobieństwo znalezienia kuponu z głowna wygrana,każdego dnia milion razy z rzędu jest prawdopodobne,bo nie równe zeru, to ja ten fakt pozostawiam bez komentarza:)
Cytat:

Z kumulacją chodzi o to, że jeśli coś mógł zrobić inteligentny kreator, to mogło to też pojawić się w wyniku przypadkowych zmian nawet jeśli to było bardzo mało prawdopodobne. (Czy w takim razie może być odróżnialne?)



Powyższe to naciągane uogólnienie, nie niosące żadnej treści (ani empirycznej,ani teoretycznej). Czy aż tak słabo wierzysz w ewolucję,że musisz się do nich uciekać?
Cytat:

5. Tak sobie myślę, że skoro fakt symulacji Behego omawiano na procesie, w którym zapadł wyrok, ze ID nie może on być częścią nauki, to ma bezpośredni związek z argumentem nieredukowalnej złożoności, którego głównym dawcą jest właśnie Behe, więc wybacz, ze nie odpowiem na twoje pytania. Po prostu wobec tych faktów nie ma potrzeby.


Sędzia, który jest prawnikiem nie musi się znać na biologii/biochemii, więc poszukaj sobie bardziej przyrodniczych argumentów,albo daj sobie spokój z obroną hipotezy, na której obronę nie jesteś przygotowany merytorycznie.
Cytat:

6. Sorry, ale argument z braku wyobraźni J.M. Smitha mnie nie przekonuje. Bardziej mnie przekonuje to, że współczesna genetyka potwierdza, ze eukarioty wyewoluowały z prokariotów.


Skoro sam nie potrafisz sobie czegoś wyobrazić dlaczego próbujesz kogoś przekonywać? W jaki sposób genetyka potwierdza ewolucje eukariotów od prokariotów możesz to opisać?
Cytat:

Sorry, ale to koniec naszego kolejnego spotkania. Zadałem sobie trud i potwierdziło się moje przypuszczenie. Z Behem i innymi argumentami byłes już i w innych miejscach w sieci, także na pl.sci.biologia, tam od fachowców otrzymałeś sprostowania i wyjaśnienia, ale jak zwykle spadły po tobie jak groch po ścianie.



Już raz Ci pokazałem co warte są takie "sprostowania", to odebrało Ci mowę. Nie mam zamiaru kopiować i wklejać tutaj kolejnych fragmentów dyskusji z innych forów. Jeśli merytorycznie wykażesz mi błędy będę z Tobą dalej dyskutował. Póki co okazujesz się wyćwiczony w erystyce i brakiem zrozumienia dziedziny w jakiej usiłujesz przekonywać.

pozdr.
Powrót do góry
Zobacz profil autora
Wyświetl posty z ostatnich:   
Napisz nowy temat   Odpowiedz do tematu    Forum ŚFiNiA Strona Główna -> Genesis Wszystkie czasy w strefie EET (Europa)
Idź do strony Poprzedni  1, 2, 3, 4, 5, 6  Następny
Strona 5 z 6

 
Skocz do:  
Nie możesz pisać nowych tematów
Nie możesz odpowiadać w tematach
Nie możesz zmieniać swoich postów
Nie możesz usuwać swoich postów
Nie możesz głosować w ankietach

fora.pl - załóż własne forum dyskusyjne za darmo
Powered by phpBB © 2001, 2005 phpBB Group
Regulamin